Advertisement

حكايات في العلم والحياة


حكايات في العلم والحياة




حكايات في العلم والحياة

موضوعات علمية غريبة ومثيرة ورائعة

تأليف
مايكل جروس

ترجمة
مروة عبد السلام
مراجعة
هبة عبد المولى



حكايات في العلم والحياة

The Birds, the Bees and the Platypuses

مايكل جروس

Michael Gross

الطبعة الأولى ????م
رقم إيداع ??????/?????
جميع الحقوق محفوظة للناشر مؤسسة هنداوي للتعليم والثقافة
المشهرة برقم ???? بتاريخ ???/???/?????

مؤسسة هنداوي للتعليم والثقافة
إن مؤسسة هنداوي للتعليم والثقافة غير مسئولة عن آراء المؤلف وأفكاره
وإنما يعبِّر الكتاب عن آراء مؤلفه
?? عمارات الفتح، حي السفارات، مدينة نصر ?????، القاهرة
جمهورية مصر العربية
تليفون: ?+ ??? ?????????        فاكس: ?+ ??? ?????????
البريد الإلكتروني: hindawi@hindawi.org
الموقع الإلكتروني: http://www.hindawi.org

جروس، مايكل.
حكايات في العلم والحياة: موضوعات علمية غريبة ومثيرة ورائعة/تأليف مايكل جروس.
     تدمك: ???? ??? ??? ??? ??

     ?- العلوم – مقالات ومحاضرات
          أ- العنوان

???

تصميم الغلاف: محمد الطوبجي.

يُمنَع نسخ أو استعمال أي جزء من هذا الكتاب بأية وسيلة تصويرية أو إلكترونية أو ميكانيكية، ويشمل ذلك التصوير الفوتوغرافي والتسجيل على أشرطة أو أقراص مضغوطة أو استخدام أية وسيلة نشر أخرى، بما في ذلك حفظ المعلومات واسترجاعها، دون إذن خطيٍّ من الناشر.
Arabic Language Translation Copyright © 2015 Hindawi Foundation for Education and Culture.
The Birds, the Bees and the Platypuses.
Copyright © 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
All Rights Reserved.
Authorised translation from the English language edition published by Wiley-VCH Verlag GmbH & Co. KGaA. Responsibility for the accuracy of the translation rests solely with Hindawi Foundation for Education and Culture and is not the responsibility of Wiley-VCH Verlag GmbH & Co. KGaA. No part of this book may be reproduced in any form without the written permission of the original copyright holder, Wiley-VCH Verlag GmbH & Co. KGaA.



تمهيد


العلم ممتع! وطوال سبع سنوات من العمل صحفيًّا هاويًا، وثماني سنوات تقريبًا من العمل كاتبًا علميًّا حرًّا بدوام كامل، كتبتُ عشرات المقالات التي ما زلتُ أتذكَّرها بولع؛ نظرًا لاستمتاعي الكبير بكتابتها (وآمل أن تكون قراءتها على هذا القدر نفسه من المتعة). تلك المقالات لم تزل تستهويني لقضاء الوقت في إعادة قراءتها لعددٍ لا حصر له من المرات إذا حدث أن صادفتُها في سجلاتي القديمة. وقد استعنتُ بهذه المقالات مرارًا وتكرارًا على مدار السنوات، مستشهِدًا بها كأمثلة، أو مُرفِقًا إياها بسيرتي الذاتية. وهذه المقالات تثبت — من وجهة نظري، على الأقل — أن العلم نشاط ثقافي على الدرجة نفسها من الثراء والتنوع الموجودين في الأدب والموسيقى، ولا يقل إمتاعًا عنهما.
فما الذي يميِّز هذه المقالات من بين قرابة ألف مقال أخرى كتبتها على مدار السنين؟ لقد حدَّدتُ ثلاثة معايير مميزة قد تعكس مقالاتي العلمية المفضَّلة معيارًا منها أو أكثر. وقد صنَّفتُها — مستعيرًا عنوانَ أحد برامج شبكة تي إل سي التليفزيونية — في جدول يحمل العناوين التالية: «الغريب والمثير والرائع». يتألف الكتاب من ثلاثة أجزاء، يتناول الجزء الأول «كائنات غريبة» الأمور المستغربة وغير المتوقَّعة والشديدة الغرابة التي يصادفها العلماء، وكثيرًا ما يكتشفون أنها مفيدة حقًّا، ومثالي المفضَّل على هذا النوع هو الأجسام المضادة الشديدة الغرابة التي عُثِر عليها في الجمل واللَّاما، التي تَبيَّن أنها مفيدة جدًّا في مجال التكنولوجيا الحيوية. وتوجد أيضًا بعض المقالات التي تدور حول تحديات مُعضِلة جدًّا، حتى إنها قد لا يتصدَّى لها سوى العلماء المهووسين بالعلم فقط، وهنا يتبادر إلى الذهن التسلسُل الجينومي لأبناء عمومتنا؛ إنسان النياندرتال. أما الجزء الثاني «علومٌ مثيرة»، فإنه يتحدث أحيانًا عن الجنس (بَدءًا من الانجذاب إلى التناسل)، ولكنه في أحيانٍ أخرى يتحدَّث عن أفكار ومشاعر استحواذية وسمات أخرى لدى الجنس البشري. وبعضه يحكي لنا فقط عمَّا يجعلنا بشرًا. وأخيرًا الجزء الثالث «تكنولوجيا رائعة»، يدور في أغلبه حول اختراعات وأجهزة وآلات وأدوات رائعة، العديد منها اخترعه علماء، بينما جاء بعضها نتاج التطور.
إنَّ كل مقال من هذه المقالات بدأ من مخطوطة أولية كتبتُها بهدف النشر (في مجلة أو جريدة)، ونقَّحتُها و/أو شرحتُها، وأضفتُ فقرة تمهيدية تفسِّر السببَ في تميُّز هذا المقال بعينه، وعند الضرورة كنتُ أرفق أيضًا تعقيبًا ألخِّص فيه تطورات أخرى. وفي كل جزء من الأجزاء الثلاثة الرئيسية، رتَّبتُ المقالات ترتيبًا زمنيًّا إلى حدٍّ ما، كي يدرك المرء أيضًا الطريقة التي تقدَّمَ بها العلمُ خلال السنوات التي تناولتُها في معالجتي. وفي نهاية كل مقال، ذكرتُ بين قوسين العام الذي نُشِر فيه المقال للمرة الأولى.
ظهر كثير من هذه المقالات في الأصل على صفحات مجلة «كميستري وورلد»، التي تصدر عن الجمعية الملكية للكيمياء، أو على صفحات سابقتها «كميستري إن بريتين». ولكن، نظرًا لأن بعض المقالات المأخوذة من مجلة «ناخريشتن أوس دير شيمي» (التي تصدر عن الجمعية الألمانية للكيمياء)، و«سبكتروم دير فيسنشافت» (النسخة الألمانية من مجلة «ساينتيفيك أمريكان»)؛ نُشِرت بالألمانية فقط، فقد ترجمتُها للاستعانة بها في هذا الكتاب. وقد ورد مقالان قديمان من مجلة «سبكتروم دير فيسنشافت» في هذا الكتاب كانعكاس للكتابين السابقين «الحياة على حافة الهاوية» و«مغامرات في عالم النانو»؛ ولهذا فجميعها أشبه بقاعة مرايا كبيرة، مثل الكروموسوم «واي» (انظر مقال «الكروموسوم الذكري مهدَّد بالانقراض»).
ظهرت بعض هذه المقالات أيضًا في جرائد «بيوفورَوم يوروب»، و«بيو آي تي وورلد»، و«كرنت بيولوجي»، و«ذا جارديان»، و«نيو ساينتيست»، و«زوددويتشه تسايتونج»، و«شيمي إن أونزرر تسايت». وإنني لَأتقدَّم بالشكر إلى جميع المحرِّرين الذين كانوا يعدون أعمالي للنشر على مدار السنوات. وقد تطوَّرَ الأمر لدى بعضهم بأن أصبح قادرًا على قراءة أفكاري؛ مما يزيد سرعةَ العملية، وييسِّر الأمور عليَّ. ولكن حتى عندما يطرحون أسئلة صعبة أو شديدة السذاجة، فإنهم يساعدونني في أن أشرك القراء في متعتي وحماسي.
إنَّ خمسة عشر عامًا مدة طويلة للغاية في مجال البحث العلمي، كما عرفتُ ذلك عند تحريري للمقالات التي تعود إلى تسعينيات القرن العشرين، التي يحمل بعضها طابعًا تاريخيًّا إلى حد ما يرجع إلى فترةِ ما قبل تحديد تسلسل الجينوم. وبعض الأمور التي اعتبرتها ممتعةً آنذاك (وما زلتُ أفعل) تبدو الآن مهمَلة، في حين تطوَّرَ البعض الآخَر تطوُّرًا مذهلًا، وحصل الآن بعض الباحثين ذوي الصلة على جائزة نوبل، في حين يبدو أن البعض الآخَر قد اندثَرَ. هكذا حال الحياة، حتى في العِلم.
مع هذا، وقبل أي شيء، آمل أن أنقل إليكم الانطباعَ بأن العلم لم يكن قطُّ مملًّا خلال الخمسة عشر عامًا الماضية، وأنه مع كل إجابة جديدة يتوصَّلُ إليها الباحثون، يُحتمَل أن تظهر فجأةً مجموعة من الأسئلة الجديدة، بل الأكثر تشويقًا أيضًا؛ لتمدَّنا بمخزون لا ينضب من الاكتشافات الغريبة والمثيرة والرائعة.
مايكل جروس
أكسفورد، مارس ????

نبذة عن المؤلف



وُلِد مايكل جروس في مدينة كيرن الألمانية، ولكنه يعتبر نفسَه مواطنًا أوروبيًّا. استهلَّ مسيرتَه بامتهان الكتابة في مجلة المدرسة، حيث تناوَلَ الفنونَ والعلوم الإنسانية بدايةً من أستريكس ووصولًا إلى بيكاسو. ونظرًا لأن أحلامه البوهيمية عن تأليف الكتب في مقهًى باريسي لم تتحقَّق سريعًا، فقد قرَّرَ دراسةَ العلوم، وتمكَّنَ أخيرًا من مزج ولَعِه بالكتابة وتمرُّسِه العلمي بمسيرته المهنية بصفته كاتبًا علميًّا متفرِّغًا، ليس في باريس، وإنما في أكسفورد. مصدر دخله الرئيسي هو المقالات التي تُنشَر له في المجلات، ولكنه يضطلع أيضًا ببعض أعمال التحرير والترجمة والمحَاضَرة، ومن وقتٍ إلى آخَر يؤلِّف كُتُبًا كاملة. وعلى الرغم من أن اهتماماته العلمية تمتد من الحوسبة الكمية إلى علم اللغة النفسي، فإن أكثر ما يتحمَّس تجاهه هو الكائنات الغريبة التي تعيش في البراكين والبحار الباردة العميقة ونبوع الماء الحارة.
تفرَّغ مايكل جروس للكتابة العلمية على مدار السنوات الثماني الماضية، ومارَسَها كهواية ليلية خلال السنوات السبع التي سبقَتْ ذلك، وهو الآن يضع بين أيدينا من ذخائر مؤلَّفاته الثمينة مقالاته العلمية المفضَّلة التي تمتد عبر هذه السنوات الخمس عشرة. تُرَى ما عوامل الجذب التي تدفعه إلى العودة إلى موضوع أو إعادة قراءة مقال ما مرات ومرات؟ في الغالب، لا يعدو الأمر كونه ولعًا بنتائج غير متوقَّعة إلى حدٍّ بعيد، أو بتحدياتٍ على قدر هائل من الأهمية، وفي مقالات أخرى، يكون ثمة عنصر مثير أو نظرة غير متوقَّعة في الحالة الإنسانية. وفي بعض الأحيان، عند تقديم تقنيات جديدة ومستقبلية، لا يسع المؤلف إلا أن يفكِّر في أنها «شديدة الروعة!» وبناءً عليه، نقدِّم إليكم في هذا الكتاب مقالاتٍ حول الغريب والمثير والرائع في مجال العلوم، ونأمل أن تستمتعوا بها.

الجزء الأول
كائنات غريبة


إذا لم تكن الفكرة غريبة منذ البداية، فلا أمَلَ يُرجَى منها.
ألبرت أينشتاين أميل بطبيعتي إلى تفضيل المقالات العلمية الغريبة بعض الشيء على المقالات التي تطرح سؤالًا مباشرًا وتجيب عنه إجابة مباشِرة، بطريقة متوقَّعة غالبًا. والغرابة التي تثير فضولي قد تنبع من المسارات العشوائية التي يتخذها التطورُ على مدار الزمن، أو ربما توجد في عقول العلماء الذين يخوضون تحديات معقَّدة للغاية، ما كان لأي إنسان عاقل أن يزعج نفسه بها، أو قد يكون الاثنين معًا، أو شيئًا وسطًا بينهما؛ فنطاق الجنون العلمي وجنون العلم لا حدودَ لهما.
لكن علاوة على ذلك، فإن بعض الموضوعات التي تناولتُها هنا بدأَتْ كطيفٍ من الجنون على هامش العلم الحديث، ولكنها تطوَّرت بعد ذلك لتصبح مجالات بحثية سائدة، بل من الممكن أيضًا أن تكون لها فرص تجارية جيدة. فلا يسعك أبدًا التنبؤ بما قد يحدث، وهذا جزء مما يجعل الموضوعات الغريبة شديدةَ الإمتاع.

الفصل الأول
دببة قصيرة متناهية الصغر


أبهرَتْني على مدى أعوام عديدة الكائناتُ المدهشة التي تعيش في أقسى ظروف الحياة على كوكب الأرض. وبما أنني قد تحدَّثتُ في أطروحتي لنيل الدكتوراه، وفي أحد كتبي كذلك، عن طبيعة الحياة في الظروف الشديدة القسوة، فلم أَعُدْ أنبهر بسهولةٍ بحكايات الحياة في المياه الشديدة الغليان أو الصحاري الحارقة أو الجليد الدائم. ومع ذلك، فإن المقال التالي (الذي لم يظهر — للأسف — إلا بعد وقت طويل من طبع النسخة الأصلية من كتاب «الحياة على حافة الهاوية») يتفوَّق على هذه المعالجات جميعًا. فإذا أراد أحدٌ أن يرسل حيوانات إلى كوكب المريخ، فإنني أقترح عليه أن يجرِّب «الدببة الصغيرة»، تلك الكائنات المعروفة أيضًا باسم دببة الماء أو البطيئات المشية. والنص التالي مقتبَسٌ بتصرفٍ من إحدى الحواشي المُضمَّنة في النسخة الورقية الغلاف من كتاب «الحياة على حافة الهاوية».
بطيئات المشية هي حيواناتٌ ميكروسكوبية دقيقة تشبه الدببة الصغيرة الحجم، ويبلغ طولها نصف ملِّيمتر على أقصى تقدير. تعيش في قُطيرات الماء المتكوِّنة على الطحالب والأُشنات، ويمكن أن توجد في جميع أنحاء العالم. والآن لو كنتَ أحدَ هذه الدببة المتناهية الصغر المُعرَّضة لكل هذه الظروف القاسية، فإنك حتمًا ستحتاج إلى بعض المهارات الخاصة جدًّا للبقاء على قيد الحياة.
لبطيئات المشية طريقتان نمطيتان رئيستان على الأقل في حالة الطوارئ؛ فإذا غمر الماء موطنها، وكان ثمة احتمال لحدوث نقص في الأكسجين، فإنها تتضخم إلى حالة خاملة كالبالون؛ مما يمكِّنها من أن تطفو على سطح الماء لأيامٍ. ومع ذلك، إذا كان التهديد بسبب نقص الماء، فإنها تنكمش لتكوِّن ما يُسمَّى الحالةَ البرميلية (لأنها تشبه البرميل)، التي يمكن وصفها بالمكافئ الحيواني للبَوْغ. وقد استطاع الباحثون إعادةَ إحياء بطيئات المشية عن طريق إعادة إماهة عينات طُحلبية بعد تخزينها لما يصل إلى ??? عام على أرفف المتاحف؛ مما يثبت ما تتسم به هذه الحالة من استقرارٍ مدهش وطويل الأجل.
شكل ?-?: صورة مجهرية إلكترونية لدب الماء. بطيئات المشية أو دِبَبَة الماء هي أكثر الحيوانات المعروفة قدرةً على الاحتمال والمقاومة.
كانت هذه الحالة البرميلية هي ما استعان بها كونيهيرو سيكي وماساتو تويوشيما (من جامعة كاناجاوا، في اليابان) في دراساتهما عن مقاومة مستويات الضغط العالية. فنظرًا لأن وجود الماء كان سيُعِيد هذه الحيوانات إلى الحالة النَّشِطة، علَّقَ الباحثان هذه الحيوانات بما هي عليه من حالة برميلية في محلول من الهيدروكربونات المشبعة بالفلور قبل تعريضها لضغطٍ وصل إلى ???? وحدة ضغط جوي (أيْ أكثر من خمسة أضعاف الضغط الموجود في أعمق أغوار المحيط). وبينما تفنى جماعات بطيئات المشية النَّشِطة في الماء بفعل ???? وحدة ضغط جوي (وهو بالفعل الحد الأقصى الذي قد يتحمَّله أيُّ حيوان)، فإن الحالةَ البرميلية أتاحت البقاءَ لنسبة ??? من أفراد أحد الأنواع، و??? من نوع آخَر في أقصى درجات الضغط الجوي التي تبلغ ???? وحدة ضغط جوي.
هذه الملاحظة غير مسبوقة بالنسبة إلى أي نوع من الحيوانات. والحيوانات الوحيدة التي يُؤمَل أن تنافِس تلك الحيوانات هي بعض الطحالب والأبواغ البكتيرية. ومع ذلك، ربما لم يندهش خبراء بطيئات المشية إلا قليلًا؛ لأنهم كانوا يعلمون فعلًا أنه من الممكن إعادة إحيائها في تلك الحالة البرميلية بعد تجميدها في الهليوم السائل؛ إذ إنها مقاوِمة للتجمُّد حتى درجة حرارة ??? درجة كلفينية. ولا توجد بعدُ تفسيراتٌ ميكانيكية مفصَّلة لهذه الاكتشافات المحطِّمة للأرقام القياسية، والشيء الوحيد المؤكَّد أن جسم بطيئات المشية في هذه الحالة البرميلية يحتوي على تركيزات عالية من تريهالوز السكر، المعروف عنه أنه يحسِّن مقاومة الضغط في خميرة الخبز.
لقد أثارَ العمرُ التخزيني الاستثنائي الذي تظل فيه بطيئات المشية في الحالة البرميلية على قيد الحياة؛ اهتمامَ الباحثين في التكنولوجيا الطبية، ويحاول بعضهم محاكاةَ طريقة بطيئات المشية لبلوغ حالة استقرار مماثلة طويلة الأجل للأعضاء البشرية لكي تُستخدَم في عمليات زرع الأعضاء.
(????)
أحدث التطورات

يسعدني أن أقول إن الباحثين قد نفَّذوا بالفعل اقتراحي وأرسلوا بطيئات المشية إلى الفضاء؛ فقد كانت تجربة «بطيئات المشية في الفضاء» — التي يُشار إليها اختصارًا بتجربة «تارديس» — جزءًا من بعثة المركبة الفضائية فوتون إم ثري، التي انطلقت في الرابع عشر من سبتمبر عام ????، وعادت بسلام في السادس والعشرين من الشهر نفسه، بعد دورانها ??? دورة حول الأرض. وفي الوقت الذي أكتب فيه هذا المقالَ، كان الركَّاب من بطيئات المشية في انتظار التحليلات المفصلة التي ستُجرَى لهم، والتي ستكشف بالتأكيد مدى ملاءمتها لتحمُّل ظروف الفضاء.
http://tardigradesinspace.blogspot.com/.قراءات إضافية

M. Gross, Life on the Edge, Plenum, 1991.

الفصل الثاني
هل يمكننا هضم البكتيريا المعوية الموجودة في المَعِدة؟


شهدت قصة البكتيريا التي يمكنها أن تصيبنا بالقُرَح تحوُّلاتٍ عديدة على مدار الزمن. فقد بدأت وجهةُ النظر القائلة إن بكتيريا المَعِدة الحلزونية أو «الهليكوباكتر» مُضِرَّةٌ للإنسان على أنها بدعة من الأساس (إذ علم الجميع أن السبب وراء القُرَح هو أحماض المعدة!) ثم سرعان ما تحوَّلت إلى اعتقادٍ راسخ (يُكمِله تقديرُ ستوكهولم بمنح جائزة نوبل لمكتشفي هذه البكتيريا)، ولكنْ دحَضَ هذا الاعتقادَ الراسخ مجدَّدًا أناسٌ يظنون أن هذه البكتيريا ربما تكون لها أيضًا آثار مفيدة. سنستعرض هنا الأساسيات فقط، لكنني سأعود إلى عرض أحدث ما ورد من أخبارٍ عن هذا الأمر قربَ نهاية هذا الجزء الخاص بالكائنات الغريبة.
عندما نعدُّ الطعام، غالبًا ما نستخدم ظروفًا قاسية، مثل درجة الحرارة المرتفعة أو وسيطًا حمضيًّا لقتل الكائنات الحية الدقيقة، وتستعين عمليةُ حفظ الأغذية من خلال الطرق الصناعية بظروفٍ إضافية أشدَّ قسوةً، منها التعقيم بأشعة جاما والضغط العالي، وتستطيع أجسامنا — حتى حدٍّ معين — الاستعانةَ بوسائل مماثلة؛ لذا، فإن إحدى وظائف الأحماض الموجودة في المَعِدة هي القضاء على البكتيريا التي تدخل أجسامنا مع الطعام.
مع هذا، لا يزال العلماء يكتشفون كائناتٍ حيةً دقيقة ذات قدرات عالية على التأقلُم، تُسمَّى «الكائنات أليفة الظروف القاسية» (المتعضيات المتطرفة)، التي تنمو حتى في الظروف القاسية. على سبيل المثال، تستطيع أليفات الحرارة العالية أن تعيش في درجات حرارة قريبة من درجة غليان الماء، كما تستطيع البكتيريا أليفة الملوحة المتطرفة (الملحاوات العصوية) أن تنمو في اللحوم المُملَّحة، بينما تستطيع بكتيريا «دينوكوكس راديوديورانس» المقاوِمة للإشعاع أن تبقى على قيد الحياة بعد التعقيم بأشعة جاما. وبالمثل، ثمة بكتيريا أخرى يمكنها أن تتَّخِذ من بيئة الفم المُعادية موطِنًا لها (كتلك البكتيريا التي تضر الأسنان)، ويمكن أن توجد في المَعِدة.
وفي تشابُهٍ كبير مع صائدي البكتيريا أليفة الظروف القاسية في دراساتهم الميدانية، اكتشف اختصاصي علم الأمراض الأسترالي جيه روبين وارين نوعًا من البكتيريا في مكانٍ من المفترض بحسب المنطق العلمي ألَّا تستطيعَ العيشَ فيه، أَلَا وهو مَعِدة الإنسان؛ فقد كانت البكتيريا الحلزونية الشكل التي صُنِّفت بعد ذلك باسم الملوية البوابية أو «هليكوباكتر بيلوري» قد اختبأَتْ في الطبقة المخاطية التي تغطِّي جدرانَ المعدة. ولم ينجح وارين وزميله باري جيه مارشال في زرع النوع الجديد من البكتيريا إلا بعد سلسلة من المحاولات الفاشلة، وعندما نشَرَا النتائجَ التي توصَّلَا إليها عام ????، أكَّدَ الباحثون في جميع أنحاء العالم ظهورَ هذه البكتيريا في المَعِدة، خاصة لدى المرضى المصابين بالتهاب المَعِدة السطحي المزمن، وهي حالة مرضية تؤدِّي إلى حدوث التهاب متكرِّر في المعدة.
مع ذلك، فإن وجود البكتيريا في نسيج مصاب لا يثبت أنها المتسبِّبة في المرض؛ فربما تكون قد استفادَتْ فقط من ضعف الجسم وغَزَتْ عضوًا مصابًا بالمرض فعلًا. أجرى مارشال ومتطوِّع ثانٍ اختبارًا ذاتيًّا ليقِفَا على حقيقة إن كان وجودُ البكتيريا هو سبب المرض أم أنه نتيجة للإصابة به. وعندما ابتلَعَ الرجلان المتمتِّعان بصحة جيدة جرعةً من «هليكوباكتر بيلوري»، أُصِيبَ كلاهما فعلًا بالتهاب في المَعِدة. وبذلك، أصبح من الواضح أن الإصابة ببكتيريا «هليكوباكتر بيلوري» غالبًا ما تؤدِّي إلى الإصابة بالتهاب المَعِدة السطحي، الذي قد لا يُلتفَت إليه غالبًا وتُلام وجبة دَسِمة على تسبُّبها في أعراضه. ولو استمرَّتِ الإصابةُ ولم تُعالَج في الوقت المناسب، فقد تؤدِّي إلى حدوث قُرَح المَعِدة، أو قُرَح الاثني عشري على المدى الطويل.
هدَمَ هذا الاكتشافُ مُعتقَدًا راسخًا قديمًا قِدَم الحضارة الغربية نفسها تقريبًا؛ أَلَا وهو أن القُرَح تنتج عن كثرة الإفرازات الحمضية في المَعِدة. فخلال القرن الميلادي الأول، نصح الطبيب الروماني سيلزوس بالأطعمة المنخفضة الأحماض للوقاية من القُرَح. ومنذ سبعينيات القرن العشرين، ظهرت عقاقير تقلِّل إفرازَ أحماض المَعِدة دون آثارٍ جانبية خطيرة، وتقلِّل بالفعل الإصابةَ بالقُرَح. ولكن، دائمًا ما كانت تعود القُرَح عند إيقاف العلاج. وعلى النقيض من ذلك، فإن العلاج بوصفات عنصر البزموت أو المضادات الحيوية التي تبيد جماعات بكتيريا «هليكوباكتر» يمكن أن يشفي من التهاب المَعِدة نهائيًّا.
لكن كيف تنجح هذه البكتيريا في العيش داخل القناة الهضمية للإنسان دون تعرُّضها للهضم؟ يبدو أن السرَّ يكمن في قدرتها الحركية وبعض الخصائص الكيميائية فيما يخصُّ عمليةَ الأيض. فالحركة مهمة عندما تتدفق محتوياتُ المَعِدة نزولًا إلى الأمعاء؛ إذ تستطيع البكتيريا الحلزونية الشكل — بمساعدة سياطها — السباحةَ بسرعة كافية لتنجو من مصير طردها خارج الجسم إلى المرحاض. أما بالنسبة إلى «الحيلة» الذكية لعملية الأيض في هذا النوع من البكتيريا، فتتمثَّل في أنها تُفرِز كمياتٍ هائلةً من إنزيم اليورياز، الذي يستطيع تكسيرَ اليوريا (أحد نواتج عملية هضم البروتينات) وتكوين الأمونيا وثاني أكسيد الكربون. وأحد التفسيرات المحتمَلة لمقاومة بكتيريا «هليكوباكتر» للأحماض أن هذه البكتيريا قد تكون قادرةً على استخدام الأمونيا المفرَزة بواسطة اليورياز لمعادَلةِ الحمض المَعِدي في بيئتها الحالية.
إنَّ ما يبدو حالةً مُدهِشة للتأقلُم مع الظروف القاسية هو أمرٌ بالِغ الأهمية في الحقيقة للرعاية الصحية في جميع أنحاء العالم؛ فقد قدَّر العلماء أن ثُلثَ سكان العالم يحملون عدوى كامنة ببكتيريا «هليكوباكتر»، لكن نسبة محدودة فقط من حالات الإصابة تؤدِّي — كما في حالة ميكروب السُّل — إلى أعراض ملحوظة للمرض. ويصاب نحو ??? من جميع البشر بالقُرَح في مرحلةٍ ما من حياتهم، وفي حالات الإصابة بالقُرَح وسرطان المَعِدة، يمكن للدراسات المقارِنة رصدُ ارتباط واضح بين عدد الأفراد المصابين ببكتيريا «هليكوباكتر» وبين الإصابة بهذين المَرضين. وتشيع حالات الإصابة بهذين المَرضين، وكذلك الأمراض التي يُعتقَد الآن أنها من مضاعفات هذين المَرضين الطويلة الأجل؛ في الدول النامية أكثر من الدول الصناعية، بَيْدَ أن كلا المَرضين شهِدَ تراجُعًا بطيئًا على مدار القرن العشرين. ويمكن لحملة وقاية واسعة النطاق من هذا الميكروب أن تكون إجراءً شديدَ الفاعلية للقضاء على القُرح وسرطانَي المَعِدة والاثني عشري.
(????)
شكل ?-?: مضاعفات الإصابة ببكتيريا «هليكوباكتر». ترمز الأحجام المتفاوتة للأسهم إلى الاحتمالات المختلفة للإصابة بالأمراض الناجمة عن هذه البكتيريا.
أحدث التطورات

في عام ????، أكملَتْ مؤسسةُ كريج فينتر لأبحاث الجينوم التسلسُلَ الجينومي لبكتيريا «هليكوباكتر بيلوري». ومنذ ذلك الحين، وُضِعت الخططُ لإبادة هذه البكتيريا نهائيًّا (إذ من شأن التسلسُل الجينومي أن يساعد في تحديدِ أهدافٍ معينة لإنتاج عقَّار مناسِب)، إلا أن بعض الباحثين اقترحوا أن آثارها الضارة على القرح وبعض أنواع السرطان يمكن معادلتها بتأدية دورٍ أكثر إيجابيةً في المساعدة على تجنُّب أنواعٍ أخرى من السرطان. ولهذا فمن غير المحتمَل حتى الوقت الراهن ظهورُ برنامج إبادة منهجي. وفي عام ????، فاز باري مارشال وروبين وارين بجائزة نوبل مناصَفةً في علم وظائف الأعضاء أو الطب «لاكتشافهما بكتيريا «هليكوباكتر بيلوري» ودورها في الإصابة بالتهاب المعدة ومرض القرحة الهضمية.»
كذلك في عام ????، اكتشف الباحثون أمرًا مدهشًا للغاية عن بكتيريا «هليكوباكتر»، ولكني سوف أُرجِئ الحديثَ عنه حتى فصلٍ لاحقٍ من هذا الجزء.
قراءات إضافية

http://nobelprize.org/nobel_prizes/medicine/laureates/2005/index.html.

الفصل الثالث
أيُّها البروتين، صحِّحْ نفسك!


في عام ????، كتبتُ مقالًا عن التسلسل الجينومي لميكروب «المكورة الميثانية الجاناشية»، وهو أول تسلسل جينومي على الإطلاق لأحد أغربِ أنواع الميكروبات المعروفة باسم العتائق، التي تختلف بعض الشيء عن البكتيريا، على الرغم من أن هذا التقسيم الجوهري لم يُكتشَف إلا في ثمانينيات القرن العشرين. وقد اقترحتُ استخدامَ مخطَّط دائري ظهر مع البحث الأصلي ويبيِّن الجينوم بأكمله في لمحة سريعة، مع تمييز الأنواع المختلفة من العناصر الوظيفية بألوان متباينة. وبما أنني لستُ حقًّا المسئولَ عن الصور التي تُرفَق بمقالاتي، فلم أُعِر انتباهًا كبيرًا إلى تفاصيل هذا المخطط، إلى أن عاد المحرِّر إليَّ بهذا السؤال: «ما معنى الإنتئين؟» اتضح أن هذه الصورة حدَّدت ?? تسلسلًا بصفتها إنتئينات، ولم تكن لديَّ أدنى فكرة عن ماهيتها، ولكنها — بالمصادفة — أصبحت مثيرةً جدًّا للاهتمام؛ لذا كان عليَّ أن أكتب تكملة لمقال الجينوم. والآن لم تَعُدِ التسلسلات الجينومية الصغيرة مثيرةً للفضول، على عكس الإنتئينات.
تخيَّلْ أنك اشتريتَ شريط كاسيت من متجر للموسيقى السحرية في حارة دياجون، وكان هذا الشريط يحتوي بداخله على شريط مغناطيسي قديم الطراز. تخيَّلْ أنكَ أخذتَه إلى المنزل، وفتحتَ العلبة، ثم لاحظتَ كتلةً معقودةً من الشريط تتدلَّى خارجه، ثم تلتفُّ هذه الكتلة على هيئة مقصٍّ وتفصل نفسها عن بقية الشريط. ولكن لكي لا تتركك القطعة المنفصلة مع شريط كاسيت غير قابل للتشغيل، فإنها تستحضر فرشاة صغيرة وصمغًا، وتلصق الطرفين المنفصلين للشريط، قبل أن تذهب في طريقها. قد يبدو لك هذا أمرًا مثيرًا للجنون، ولكن لو استبدلت بالشريط المغناطيسي شريط الحمض النووي الريبي (آر إن إيه)، أو البروتين في واقع الأمر، فسيبدو هذا منطقيًّا.
كانت الإنتئينات — وهي بروتينات تتمتع بالقدرة على تضفير نفسها — تُعتبَر من الأمور الغريبة إلى حدٍّ ما حتى عام ????. وداخل التسلسل الجينومي ? «المكورة الميثانية الجاناشية» — وهو أول جينوم من مملكة العتائق — تم اكتشاف ?? تسلسلًا في ?? جينًا مختلفًا؛ مما يضاعف عدد الأمثلة المعروفة. تشبه الإنتئينات إنترونات الحمض النووي الريبي؛ إذ تستطيع أن تقص نفسها وتحرِّرها من رابطة طويلة لمتعدد الببتيدات، وأن تلحم الأجزاء المتبقية (التي تُسمَّى بالإكستينات والشبيهة بإكسونات الحمض النووي الريبي). إلا أن هذه العملية لم تُكتشَف حتى عام ????، ولم تلقَ اهتمامًا كبيرًا كالذي حظيت به عملية تضفير الحمض النووي الريبي.
على الرغم من أن معظم الأمثلة المعروفة للإنتئينات ترجع إلى مملكة العتائق (أو الجراثيم العتيقة سابقًا) التي شاع عنها أنها غريبة، فقد اكتُشِف النموذجُ الأوليُّ في كائن حي كثيرًا ما استُخدِم في الأبحاث العلمية وخدم البشرية على مدار قرون من الزمان؛ أَلَا وهو خميرة الخُبز. لاحَظَ توم إتش ستيفنز وزملاؤه بجامعة أوريجون في مدينة يوجين أن جين «تي إف بي ?» TFP1 في الخميرة من الواضح أنه يقوم بالتشفير لإنتاج بروتينين. ويتم تشفير البروتين الأصغر في المنطقة الوسطى من الجين، ويلاصقه النصفان المنفصلان للبروتين الأكبر. لم يكن هذا الاكتشاف في حدِّ ذاته مميزًا؛ إذ يوجد العديد من الأمثلة للجينات المتداخلة أو المتشابكة، ولكن العجيب في الأمر أنه بدلًا من إنتاج الشريطين الرسولين للحمض النووي الريبي كما هو متوقَّع (أيْ شريط لكل بروتين ناتج)، فإن شريطًا واحدًا فقط هو الذي تكوَّن، وتطابَقَ طولُه مع مجموع الأطوال المتوقَّعة. ولهذا شكَّ فريق ستيفنز في أن المعلومات الجينية لم تُصحَّح على مستوى الحمض النووي الرسول، كما في العديد من الحالات الأخرى. وبدلًا من ذلك، بَدَا أن الشريط الأحادي من الحمض النووي الرسول قد تُرجِم إلى بروتين اندماج واحد، ينقسم إلى المكونَيْن النهائيَّيْن بعد الترجمة الجينية. لاختبار صحة هذه الفرضية، أحدَثَ الباحثون طفرات في الجزء الأوسط من الحمض النووي الرسول؛ مما أدَّى إلى ترحيل في القراءة، أيْ إلى خطأ في تقسيم شريط النيوكليوتيدات (الحروف) إلى كلمات مكوَّنة من ثلاثة حروف تحدِّد الأحماض الأمينية المفترض دمجها في البروتين. وهذا النوع من الطفرات لا يؤثِّر على الكلمة التي يَحدُث فيها فحسب، بل يتعرض أيضًا النصُّ كله الموجود خلفه للتشويه. لو كان قد حدث تضفير على مستوى الحمض النووي الرسول، فإن طفرةَ تغيُّر الإطار لم تكن ستؤثِّر إلا على الإنترون المقطوع من الحمض النووي الرسول، في حين ستظل الإكسونات المُضفَّرة محتفظةً بالإطار الصحيح. لهذا السبب، يجب عدم إحداث طفرات إلا في البروتين الذي جرى تشفيره بالمقطع الأوسط، وليس في البروتين الذي جرى تشفيره بالمقاطع الخارجية. ومع هذا، فقد اكتُشِف أن كلا البروتينين قد تأثَّرَا بطفرة تغيُّر الإطار، (بالطبع، يجب أن يأخذ المرء حذره من ألَّا تؤثِّر الطفرات الموجودة في الجزء الأوسط على تفاعل التضفير، وهو ما يمكن تأكيده بالأوزان الجزيئية للبروتينين الناتجين.) إلا أن الباحثين فشلوا في عزل البروتين الطليعي غير المشقوق؛ مما دفعهم إلى الشك في أن التضفير قد يكون عمليةً ذاتيةَ التحفيز. في هذه الحالة، سيعمل البروتين نفسه على تسريع تفاعُل التضفير لدرجة أنه سيكون من المستحيل الإمساك بناتج الترجمة الأصلي.
لم يكن بالإمكان تخطِّي هذه المعضلة إلا بعد اكتشاف الإنتئينات أيضًا في العديد من العتائق أليفة الحرارة العالية، مثل بكتيريا «ثيرموكوكوس ليتوراليس» وسلالات متنوعة من بكتيريا «بيروكوكوس». صمَّمت فرانسين بي بيرليه وزملاؤها في مختبرات نيو إنجلاند بايولابس نظامًا صناعيًّا للتضفير الذاتي حول الإنتئين الخاص ببُوليميِراز الحمض النووي لبكتيريا «بيروكوكوس»؛ وذلك عن طريق وضع الجين المسئول عن إنتاج بروتين رابط للمالتوز «إم» M أمامه (باعتباره إكستين «إن» N، كما هو عند نهاية الطرف الأميني من التسلسل)، ووضع الجين المسئول عن إنتاج الباراميوزين «بي» P خلفه (باعتباره إكستين «سي» C، للطرف الكربوكسي). وقد قدَّموا الجينَ الناتج عن هذا الاندماج إلى بكتيريا «الإشريكية القولونية» المعوية (وهي وسيلة معملية شائعة الاستخدام)، التي نجح جهازُ تصنيع البروتين بها في إنتاج متعدِّد الببتيدات المندمج (إم آي بي) عند درجات حرارة تتراوح بين ?? و?? درجة مئوية. عند درجات الحرارة المنخفضة هذه، لم يحدث تفاعل التضفير الذاتي إلا ببطء شديد، لكون الإنتئين المستخدَم مأخوذًا من كائن حي يستطيع التكيُّف مع الحياة قرب نقطة غليان الماء. وفي واقع الأمر، أُبطِئت العملية برمتها إلى الحد الذي أتاح للباحثين تنقيةَ البروتين الطليعي غير المُعالَج. فعن طريق تحضين متعدِّد الببتيدات هذا في محاليل مائية لا تحتوي إلا على كميات صغيرة من كلوريد الصوديوم والمحلول المنظم الفوسفاتي، ثم تسخينها ببطء؛ نجحوا في ملاحظة بداية التضفير الذاتي عند درجات الحرارة المرتفعة. وبهذه الطريقة، استطاعوا أيضًا عَزْلَ مركَّب وسيط (وهو «إم آي بي»؛ أي متعدِّد الببتيدات المندمج)، جاء سلوكه مناقِضًا إلى حدٍّ ما؛ إذ بَدَا أنه يتمتع بوزن جزيئي أكبر من مركب «إم آي بي»؛ لأنه كان يتحرك على نحو أكثر بطئًا عبر الجِل الرحلاني، كما بَدَا أنه يحمل نسختين مختلفتين من الطرف الأميني («بداية» رابطة بروتينية). حُلَّ اللغز عندما اكتشفوا أن المركَّب الوسيط يحمل بكل وضوح بنيةً متفرِّعةً، أدَّى كبر حجمها إلى تقليل الحركة داخل الجِل. وما حدث حتمًا أن كلًّا من الإكستين «إم» و«بي» كوَّنَا رابطة، على الرغم من استمرار ارتباط الإكستين «آي» I بالإكستين «بي». بالإضافة إلى قدرة الإنتئينات على التضفير الذاتي، فإنها تشترك مع إنترونات معينة في مزيدٍ من الخصائص؛ أو بشكل أكثر تحديدًا، مع بروتينات معينة ناتجة عن ترجمة الإنترون. ويعمل كلاهما كنيوكليز داخلي؛ مما يعني أنهما يستطيعان التعرُّفَ على تسلسلات معينة للأحماض النووية، وقصَّ الحمض النووي عند موضع محدَّد داخل هذه التسلسلات أو بالقرب منها. وهما يختصان بمقاطع الحمض النووي التي تميِّز الجين «الأصلي»، ولكنهما يفتقران إلى تسلسل الإنترون أو الإنتئين. وهكذا، فإنهما يقصَّان الجينَ عند الموضع المطابِق، وبالتالي يحفِّزان آلية «الإصلاح»، التي قد تستعين بنسخةٍ من الجين تحتوي على إنترون/إنتئين كقالب نموذجي، فتُنتج بذلك التسلسُل الدخيل وتضيفه إلى الجين.
لم تُثبَت هذه العملية — التي كانت تُعرَف سابقًا باسم «توطين الإنترون» — بهذه الدرجة إلا لهذه الإنتئينات الأربعة المعروفة، ومع ذلك، يُستنتَج من المقارنات بين التسلسلات أن جميع الإنتئينات المعروفة مرتبطة على الأقل بالنيوكليزات الداخلية، حتى لو خسر بعضها وظيفة التوطين خلال تطوُّره الأخير. كما يوحي التوزيع المتفاوت لتسلسلات الإنتئين بين سلالات ممالك الحياة الثلاث جميعًا بأن نشاط النيوكليز الداخلي هذا قد أتاح انتشارَ الإنتئينات بسهولة بفضل الانتقال الجيني الأفقي (أي الانتقال بين السلالات الحديثة).
لماذا قامت الإنترونات والإنتئينات الذاتية التضفير بتطوير وظيفة النيوكليزات الداخلية الخاصة بالتوطين؟ حسنًا، ربما طُرِح هذا السؤال على نحو معكوس، إذا عكسته فستكون الإجابة واضحة. لماذا تتسم النيوكليزات الداخلية الخاصة بالتوجيه بالتضفير الذاتي، سواء على مستوى الحمض النووي الريبي أو البروتين؟ من المحتمَل أن يكون الإنزيم القادر على قصِّ جين ليضع فيه محتواه الجيني مُهلِكًا لأية خلية؛ إذ إنه سيدمِّر في وقتٍ ما جينًا مهمًّا. ولكن لو أمكن إصلاحُ الضرر عند مستوى الحمض النووي الريبي أو البروتين، عن طريق التسلسل الدخيل الذي يحفِّز تفاعُلَ التضفير ليعيد بناء المنتج الأصلي، فسيكون كل شيء على ما يرام.
وهكذا، فإن نشاط الإنترون أو الإنتئين هو الحالة التي يجب أن يصل إليها أي عنصر جيني متحرِّك لكي تتقبَّلَه الخلية. ولو فشل في هذا، فإنه سيدمِّر خليته المضيفة ولن تبقى له سوى فرصة واحدة للنجاة؛ أَلَا وهي اكتساب القدرة على إصابة الخلايا الأخرى، وبالتالي يصبح من الفيروسات. لهذا، فعلى الأرجح أنه ليس من قبيل المصادفة أن يكون التصحيح الذاتي على مستوى البروتين ملحوظًا على نحو شائع في الفيروسات. فالمادة الجينية، على سبيل المثال، لفيروس نقص المناعة البشرية (إتش آي في) المسبِّب لمرض الإيدز؛ تقوم بتشفير رابطة طويلة من متعدِّد الببتيدات تحتوي على جميع البروتينات الفيروسية مترابطة معًا. ويعمل نشاط البروتياز الخاص بفيروس نقص المناعة البشرية الموجود في هذا البروتين المتعدد على انقسام الجزيء لتكوين البروتينات المطلوبة.
ربما يكون «الهدف» البيولوجي من الإنتئينات (التي من الواضح أنها عديمة الفائدة بالنسبة إلى الخلية، وتعيش فقط لأنها تساعد في نشر جيناتها دون أن تضرَّ الخليةَ كثيرًا) هو النظر إليها بصفتها بشيرًا تطوريًّا أو بديلًا مسالمًا للفيروسات. ويجب أن يبقيها المرء بالتأكيد تحت الملاحظة.
(????)
أحدث التطورات

أصبحَتِ الإنتئينات الآن متاحةً تجاريًّا كجزء من أدوات التعبير البروتيني التي تتيح للباحثين إنتاجَ بروتين اصطناعي معيَّن وتنقيته في خطوة واحدة. وتتمحور الفكرة حول تشفير ما يُعرَف باسم علامة التقارب عند أحد طرفَي الجين؛ مما يضمن أن يحظى ذيلُ البروتين الاصطناعي بتقارب ارتباطي قوي ومحدَّد تجاه مادة معينة، مثل الكيتين. وهكذا، يُصبِح من السهل تنقيته بتمرير المستخلص الخلوي عبر عمودِ فَصْل يحتوي على هذه المادة، حيث يرتبط بها البروتين المطلوب في حين يمرُّ كلُّ شيء آخَر بسرعة؛ وبذلك يضمن تسلسُل الإنتئين الموجود بين العلامة والبروتين أن تنفصل العلامةُ بعد التنقية دون الحاجة إلى أي إجراء إضافي.
قراءات إضافية

F. B. Perler and E. Adam, Curr. Opin. Biotechnol, 2000, 11: 377.
C. J. Bult et al., Science, 1996, 273, 1066.

الفصل الرابع
اكتشافٌ مذهل من قلب الصحراء


بدأ هذا المقال بحالة من الغموض اعترَتْ حوارًا دارَ في مكتبي خلال الفترة التي كنتُ لا أزال أزاول فيها أعمالي البحثية في جامعة أكسفورد. كان أحد الزملاء السابقين قد عاد ليُجرِي بعضَ التجارب في مشروعٍ تعاوني لم أكُنْ أعلم عنه شيئًا، وعندما سألته عن طبيعة تجاربه، قال إنه كان يدرس التفاعلَ بين إنزيم الليزوزيم والأجسام المضادة في الجَمَل. كانت كلمة «الليزوزيم» هي الشق الممل في تلك الجملة؛ إذ كان جميع مَنْ في هذا المعمل على درايةٍ بهذه الوسيلة التقليدية التي تجمع بين دراسة البروتين والإنزيم. أما الشق الثاني فكان جديدًا بالنسبة إليَّ؛ لذا أنصتُّ له وسألتُه: «الجَمَل؟ ما المميَّز في الجَمَل؟» فأخبرني، ولا بد أنني حكيتُ هذه القصة عشرات المرات بصور شتى، ولكنها تظل إحدى قصصي المفضَّلة.
بدأ الأمر بحالة إضراب عمَّتْ أحدَ المعامل التعليمية بالجامعة، خلال وقتٍ ما في أواخر ثمانينيات القرن العشرين؛ فقد طُلِب من مجموعة من طلاب مادة الأحياء إجراءُ تجارب المناعة التي سبق وأجراها من قبلهم عددٌ لا يُحصَى من الطلاب، حيث يجمعون الأجسامَ المضادة من مصلِ دمٍ بشريٍّ، ويفصلونها إلى مجموعات مختلفة. لكنهم لم يتحمَّسوا للتجربة؛ خشيةَ احتواءِ المصل على فيروس نقص المناعة البشرية، وكذلك لأن نتائج التجربة كانت معروفة وموثقة بالفعل في كتبهم الدراسية، فعرض عليهم أساتذتهم التضحيةَ ببعض الفئران بدلًا من ذلك، ولكن هذا الخيار لم يَلْقَ قبولًا بدوره. وأخيرًا، عُثِرَ على بضعة لترات من بقايا أحد الأمصال في ثلاجات معامل الأبحاث، وكانت مأخوذةً من الإبل العربية. ألهبَتْ هذه العينةُ الغريبة حماسَ الطلبة بما يكفي ليعلِّقوا إضرابهم ويبدءوا العمل على فصل الأجسام المضادة. وبالفعل رصدوا التوزيعَ المعتاد للجلوبولين المناعي الذي يتوقَّع المرء أن يراه، ولكنهم اكتشفوا أيضًا مجموعة من الأجسام المضادة الأصغر حجمًا التي لا تشبه أيَّ شيءٍ عرفه العلم.
حدثَتْ هذه الواقعةُ في جامعة بروكسل الحرة، وكان من الممكن أن تظل غامضةً، لولا أن تقصَّى الأمرَ باحثان من هذه الجامعة، وهما ريموند هامرز وسيسيل كاسترمان؛ فقد كانا مقتنعين بأن الأجسامَ المضادة الأصغر حجمًا لم تكن مجرد نُسَخ متكسِّرة من الأجسام الحقيقية، وإنما كانت ذات طبيعة خاصة. كرَّرَ الباحثان التجاربَ التي أجراها الطلبة بعيِّنات حديثة من حيوانَي الجَمَل واللاما، وأكَّدَا أن جميعَ الحيوانات المنتمية إلى هذه الفصيلة (الإبليات) تُنتِج بعضَ الكميات من الأجسام المضادة التي تختلف اختلافًا كبيرًا عن الأجسام التقليدية، من حيث إنها تفتقر إلى جزيئَي البروتين المعروفَيْنِ باسم السلاسل الخفيفة. فهي تتكون من السلاسل الثقيلة فقط؛ مما يفسِّر سببَ تسميتها الآن بالأجسام المضادة الثقيلة السلاسل. (في حالة الأجسام المضادة العادية، يتكوَّن زوجٌ من السلاسل الثقيلة في شكل Y متناسِق، مع ارتباط سلسلةٍ خفيفة واحدة بكلا الفرعين، انظر الشكل ?-?.) شكل ?-?: الأجسام المضادة في الجَمَل. يمثِّل الجسمُ المضاد العادي (يسارًا) — الموجود عادةً في الفقاريات — الشكلَ Y ويتكوَّن من سلسلتين ثقيلتين وسلسلتين خفيفتين. وبينما تشكِّل السلسلتان الثقيلتان قدَمَ ا? Y، تتكوَّن كلتا الذراعين من سلسلة ثقيلة واحدة وسلسلة خفيفة واحدة. وبالمثل، يتكوَّن موضعُ ارتباط مُولِّد المضاد (المُسْتَضِد) من أجزاءٍ متساوية من السلسلتين الثقيلة والخفيفة. تتكوَّن الأجسام المضادة المميزة الثقيلة السلاسل الموجودة في حيوانَي الجَمَل واللاما (يمينًا) من السلاسل الثقيلة فقط. وبهذا، تتكوَّن مواضعُ الارتباطِ بها من جزيء واحد فقط، وتظلُّ تقوم بوظيفتها في غياب الكتلة الكبيرة المتبقِّية من الجسم المضاد.
من الصعب التعامُل مع الأجسام المضادة العادية؛ فهي تجمُّعات جزيئية معقَّدَة، ويصعب للغاية إنتاجُها في البكتيريا، وحجمها كبير للغاية إلى الحدِّ الذي لا يجعلها تصلح للعديد من التطبيقات الطبية، كما أنها قد تُحفِّز استجابةً مناعيةً غير مرغوبة لدى المريض، (أجل، توجد أجسام مضادة تقاوِم الأجسامَ المضادة!) ولهذا السبب حاولَتْ فِرَقٌ عديدة من الباحثين إيجادَ بديل أبسط، لتكوين أجسام مضادة صغيرة تجمع بين خاصيةِ الارتباط التي يتميَّز بها الجسم المضاد الحقيقي وقدرٍ أكبر من سهولة الاستخدام. وكان سيرج مويلدرمانز ولود وينز، اللذان يعملان بدورهما في جامعة بروكسل الحرة، يُجرِيان بحثًا في هذا الشأن، فعكفا على دراسة الجِمال، ولكنها كانت رحلةً مُضنِية. ففي البداية، لم يكن من الواضح مطلقًا إن كانت هذه الجزيئات أجسامًا مضادة سليمة تتمتَّع بنفس قابلية الأجسام المضادة الحقيقية للتغيُّر والتخصُّص. وكانا بحاجةٍ إلى جَمل لتحصين مناعته بمولِّد مضاد (مُسْتَضِد) محدَّد، والانتظار لمدة عام، ثم النظر فيما إن كان الجَمل قد أنتَجَ أجسامًا مضادة ثقيلة السلاسل مقاوِمة لهذه المادة. وبالفعل سافَرَ فريق من الباحثين إلى المغرب، واشترَوا جَملًا، وحصَّنوا مناعته … لكنه سُرِق منهم قبل أن يحصلوا منه على المصل الثمين!
أمكن التغلُّب أخيرًا على هذه المشكلات الإجرائية بمساعدةٍ ملَكيةٍ بسيطة؛ فصاحب السمو الشيخ مكتوم بن راشد آل مكتوم، الذي كان وقتها حاكم إمارة دبي في الإمارات العربية المتحدة، سانَدَ البحث بتقديم مصل جَمل من مركز الأبحاث البيطرية المعروف التابع له. وما اكتشفه الباحثون عن الأجسام المضادة للجَمل كان مشجِّعًا أكثر مما يأملون فيه على إدخال تطبيقات له في مجالَي الطب والتكنولوجيا الحيوية.
اتضح أن الأجسام المضادة الثقيلة السلسلة تستطيع — مثلها مثل الأجسام المضادة العادية — التعرُّفَ على مجموعة كبيرة من مولِّدات المضاد (المُسْتَضِدات)، ولكنها تتفاعل معها في مواضع مختلفة؛ لذا تستطيع الأجسامُ المضادة الثقيلة السلسلة التي تُطلَق ضدَّ الإنزيمات الصغيرة مثل الليزوزيم أو الريبونيوكليز أن تخترق الموضع النَّشِط وتحقن الإنزيم بمثبط قوي، في حين ترتبط الأجسام المضادة التقليدية بموضعٍ ما سهلِ الاختراق.
يتلخَّص الأمر كله في حقيقة أنه في حالة الجسم المضاد التقليدي، يتمُّ التعرُّفُ على مولِّد المضاد (المُسْتَضِد) عبر موضعين (عند الطرفين العلويين من الشكل Y)، يتكوَّن كلٌّ منهما من جزيئين مختلفين، وهما سلسلة ثقيلة وأخرى خفيفة؛ مما ينتج عنه تجمُّع ضخم إلى حدٍّ ما. أما في حالة الأجسام المضادة الثقيلة السلسلة، فيوجد كلُّ موضعِ ارتباطٍ في منطقةٍ ضيقةِ المجال بأحد الجزيئين، أَلَا وهي النطاق المتغيِّر للسلسلة الثقيلة. وهذا يفسِّر سببَ وصولها إلى الأجزاء التي لا تستطيع الأجسام المضادة الأخرى الوصولَ إليها، كما يعني أيضًا أنه من الأسهل تصغيرُ هذا الجسم المضاد إلى حدٍّ أكبر. إذا أردتَ تصغيرَ جسم مضاد بشري بقصِّ جميعِ الأجزاء غير المشتركة في عملية الارتباط، فستواجِه صعوبات جمَّة كي تحاول الحفاظ على نطاقات الارتباط الخاصة بالسلاسل الثقيلة والخفيفة معًا. لكن في حالة الجسم المضاد للجَمل، يمكنك ببساطة أن تعزل جينيًّا الحمضَ النووي الخاص بنطاق الارتباط، وتستعين بالبكتيريا لإنتاجه، فتحصل على جسم مضاد مصغَّر، يُعرَف لدى العلماء باسم الجسم المضاد الوحيد النطاق. تُعتبَر الأجسام المضادة الوحيدة النطاق الأداةَ المثالية للعديد من التطبيقات، بدايةً من أدوات البحث العلمي ووصولًا إلى الأدوات التشخيصية التي يمكن استخدامها في المنزل. ومن مجالات التطبيق الواعدة للغاية تصويرُ الأنسجة الحية، ولا سيَّما تشخيص السرطان. عند محاولة تحديد موضع ورمٍ ما، فإنك تحتاج إلى علامة واسمة، تلك التي فضلًا عن تعرُّفها على الجزيئات المحدَّدة الموجودة على الخلايا السرطانية، فإنها تخترق أيضًا الورمَ بسهولة. وبمجرد نجاحها في هذا وارتباطها بالخلية المستهدَفة، فإنك ستحتاج أن تطرد بسهولةٍ أية مادة متبقية غير مرتبطة، لكي لا تظهر في الصورة. تعجز الأجسام المضادة العادية عن تلبية هذه المتطلبات، إلا أن الاختبارات الأولية تشير إلى أن المُرتبِطات الوحيدة النطاق المأخوذة من الأجسام المضادة الثقيلة السلاسل في الجِمال يمكن استخدامُها لهذا الغرض. كما يبدو أنها لن تُحدِثَ في العادة استجابةً مناعية، على عكس الأجسام المضادة (غير البشرية) ذات الحجم الكامل. علاوة على هذا، يتيح صِغَر حجم هذه الجزيئات للعلماء استخدامَها كمكونات أساسية في التركيبات التي قد تضمُّ موضعين مختلفين من مواضع الارتباط، أو حتى موضع ارتباط متَّحِدٍ بنشاط إنزيمي أو غيره. بل يمكن أيضًا استخدامُها داخل الخلية، باعتبارها أجسامًا مضادة داخلية.
أحد الأمثلة الشائعة لمنتَجٍ استهلاكي يعتمد على الأجسام المضادة هو جهاز اختبار الحمل المنزلي الذي تغمسه المرأة في عيِّنَة بول، ثم تفحصه لترى إن كان قد ظهر خطٌّ أزرق أم لا. يحتوي أحد أشكال هذا الجهاز — الذي صُمِّمَ للإشارة إلى وجود هرمون حمل معيَّن — على نوعين مختلفين من الأجسام المضادة لهذا الهرمون، يلتصق أحدهما بالدعامة الصلبة الموجودة في منطقة النافذة التي من المفترض أن يظهر فيها الشريطُ الأزرق في حالة وجود حمل، وعندما تسبح جزيئات الهرمون عبرها، تلتصق بها هذه الأجسام المضادة. أما النوع الثاني من الأجسام المضادة، ذلك الذي يتعرَّف على جزءٍ مختلف من جزيء الهرمون، فمليء بجسيمات زرقاء اللون، عندما تمر هذه المجموعة الثانية بجزيئات الهرمون المرتبِطة بقوة بالمجموعة الأولى، فإنها ترتبط بها وبالتالي تجعل اللون الأزرق يتراكَم في النافذة. وبما أن هذا النوع من الاختبارات يتطلَّب نوعين من الأجسام المضادة التي ترتبط بالجزيئات المستهدَفة بطرقٍ مختلفةٍ بحيث لا تتدخَّل في ارتباطِ بعضهما ببعض، فسيكون من المناسب استخدام مزيج يجمع بين الأجسام المضادة التقليدية الموجودة على السطح الصلب، وبين الأجسام المضادة المأخوذة من الإبل والموجودة في السائل.
(????)
أحدث التطورات

منذ عام ????، بدأت إحدى الشركات المروِّجة لهذا الاكتشاف، وتُدعَى أبلينكس، في تطوير عددٍ من المنتجات بناءً على الفوائد التي تقدِّمها الأجسامُ المضادة المأخوذة من الإبل. وفي عام ????، صار لدى أبلينكس أكثر من ?? موظَّفًا وعقود مع العديد من الشركات العملاقة في مجال صناعة الأدوية. وقد دخل مؤخَّرًا أولُ دواء يعتمد على الأجسام المضادة المأخوذة من الإبل في الطور الأول من التجارب السريرية، ونحن في انتظار النتائج.
قراءات إضافية

S. Muyldermans et al., Trends Biochem. Sci., 2001, 26, 230–235.
T. N. Baral et al., Nature Med. 2006, 12, 580.

الفصل الخامس
الأسباراجين والشريط القديم


خلال سنوات مراهقتي، كنتُ قارئًا نَهِمًا للرياضيات العامة، بما في ذلك كتب مارتن جاردنر صاحب أحد الأعمدة الصحفية في مجلة «ساينتيفيك أمريكان»؛ ومن ثَمَّ، فإن أيَّ شيء يمكن أن يربط هذا العالم بالعالَم الذي أصبحتُ أعمل فيه لاحقًا — وأقصد تحديدًا البروتين — سيثير فضولي لا شكَّ في ذلك. لقد اعتاد علماء دراسة البروتين استخدامَ كلمة «طوبولوجيا» في غير موضعها الصحيح، في حين أنهم يشيرون ببساطة إلى البنية البروتينية. ومع هذا، ففي هذا التشابُك بين علمَي البروتين والرياضيات، توجد طوبولوجيا فعلية مُتضمَّنة، نتيجةَ ربط سلاسل البروتين في عُقَد.
توصَّلَ كيميائيو الجزيئات الفائقة إلى طرق ذكية لإنتاج التجمُّعات الجزيئية، مثل: العُقَد والحلقات المتداخلة (مُركَّبات الكاتينان). وبَدَا أنه ابتكارٌ جديدٌ وممتعٌ، بل مفيدٌ أيضًا أحيانًا، ولا مثيل له في الطبيعة، باستثناء الحمض النووي الذي يمكن ربطُه في حالات معقَّدَة طوبولوجيًّا بسبب بنية اللولب المزدوج التي يتسم بها واعتياده على تشكيل الحلقات. بالنسبة إلى البروتينات، التي تُعتبَر أكثرَ البوليمرات البيولوجية تنوُّعًا من الناحية البنيوية، كان يُفترَض أن تظلَّ مستقيمةَ الشريط من حيث المبدأ، ولكن في عام ????، ثبَتَ أن البروتينات الطبيعية تستطيع تشكيلَ كلٍّ من العُقَد ومُركَّبات الكاتينان.
تحدَّثَ جون جونسون وزملاؤه من معهد سكريبس البحثي إلى مجلة «ساينس» عن البنية العالية الدقة التي تتَّسِم بها «رأس» بروتين فيروس HK97. ومع أن معظم البِنى البروتينية المعروفة حاليًّا لا تتفاوَتُ إلا في نواحٍ معروفة جيدًا، فإن هذا الفيروس كان يحمل مفاجأتين رئيستين؛ يتمتَّع جزيء البروتين في حدِّ ذاته ببنية ثلاثية الأبعاد ذات نمط (أو «طية») غير مرصود من قبلُ، لكنَّ المفاجأةَ الكبرى كانت فيما يحدث بين الجزيئات البروتينية البالغ عددها ??? جزيئًا، التي يتكوَّن منها الغلاف الخارجي. فبمجرد تجمُّعِها في البِنية الكروية الشكل، لا تقنع بالاتحاد مع بعضها البعض من خلال روابط ضعيفة لا تساهمية، على عكس ما تفعله عادةً الوحدات البروتينية الفرعية ذات الأنظمة التجميعية المعقدة. بل إنها تشكِّل رابطة أميدية جديدة من مركب الأمين الأولي الذي ينتج عن بقايا حمض اللايسين لإحدى الوحدات، بالإضافة إلى مركب الأميد في حمض الأسباراجين الأميني المجاور له. بمجرد أن يحدث هذا ??? مرة، فإن كل جزيء بروتيني لا يجد نفسه مرتبطًا تساهميًّا بحلقة تضمُّ أربعة أو خمسة جزيئات مثله فحسب، بل يجد أيضًا أنه مقيَّد على نحوٍ لا يمكن فكُّه بالحلقات المجاورة له، وبالتالي يكون مقيَّدًا بالتجمُّع بأكمله. لهذا، تشكِّل ?? حلقة سداسية التفاعيل و?? حلقة خماسية التفاعيل شبكةً ثلاثية الأبعاد لا يمكن فكُّها إلا بتكسير الروابط الكيميائية؛ مما يفسِّر حالة الاستقرار الاستثنائية التي يتميَّز بها الغلاف الخارجي، والتي تُنتَج بوفرة باستخدام بروتينٍ أقل مما كانت تستدعيه الحاجة.
قبل ذلك بأقل من شهرٍ، أثبَتَ ويليام تيلور من المعهد الوطني للأبحاث الطبية في ميل هيل بمدينة لندن وجودَ سلاسلَ بروتينيةٍ معقودة بقوة، وذلك عن طريق فحص البِنى المعروفة من خلال اللوغاريتمات الجديدة التي طوَّرها بنفسه، والتي تعمل بصفة أساسية على ربط طرفَي السلسلة البروتينية بإحكامٍ ثم تقليص السلسلة. سينتهي المطاف بمعظم السلاسل إلى صورة خط مستقيم بين موضعَي الطرفين، ولكن اتضح أن بعضها يكون معقودًا. وأكثر العُقَد تعقيدًا التي أمكن ملاحظتها كانت عقدةً على شكل الرقم ? موجودةً في البروتين المزروع «أسيتوهيدروكسي أسيد أيزوميرورداكتيز».
شكل ?-?: بروتين متشابِك. استعان الباحثون بتقنيات حاسوبية متقدِّمة من أجل «شدِّ» كِلَا طرفَي السلسلة البروتينية، واكتشافِ إن كانت معقودةً أم لا. في هذه الحالة، تبيَّنَ وجودُ عقدة.
أحدث التطورات

في عام ????، أعلَنَ باحثون من معهد ماساتشوستس للتكنولوجيا عن اكتشافهم أكثر العُقَد تعقيدًا التي أمكن رصدها داخل بروتين؛ فبعد شدِّهم شرائطَ أكثر من ?? ألف بنية بروتينية، اكتشفوا عدة عُقَد ثلاثية أو رباعية التشابُكات، ولكنَّ عقدةً واحدةً فقط حطَّمت الرقم القياسي بخمسة تشابُكات (انظر الشكل ?-?). البروتين المتشابِك هو إنزيم هيدروليز أبوكويتين، الذي يلعب دورًا مهمًّا في تحديد البروتينات التي تتكسَّر حتمًا عن طريق جهاز إعادة تدوير البروتينات داخل الخلية، وهو البروتيسوم. على وجه التحديد، يزيل الهيدروليز علامةَ الأبوكويتين، وبالتالي ينقذ البروتينات من الإبادة المحقَّقة. وقد خمَّن الباحثون في معهد ماساتشوستس للتكنولوجيا أن العقدة المعقَّدَة ربما تكون وسيلةً وقائيةً خاصة تمنع الإنزيم — المرتبط ارتباطًا وثيقًا بعلامة الأبوكويتين المميتة — من أن ينتهي به المطاف في سلة مهملات الخلية. قراءات إضافية

W. R. Taylor and K. Lin, Nature, 2003, 421, 25.

الفصل السادس
أسبابٌ أفضل لتقبيل ضفدع


خلال الفترة التي كنتُ فيها طالبَ دكتوراه نَهِمًا للمعرفة، كنَّا نحضر حلقاتٍ دراسيةً نظرية، تتضمن عروضًا تقديمية طويلةً بعض الشيء عن موضوعاتٍ ربما تكون بعيدةً كلَّ البُعْد عن الاهتمامات المعتادة لمجال بحثنا. وأذكرُ أحدَ المتحدثين وهو يعلن أنه سيتكلَّم عن الببتيدات المأخوذة من جلد الضفادع، وأذكرُ بوضوحٍ شديد أنني كنتُ أتساءل: «عمَّ يتحدَّث؟!» ولكن بنهاية الحلقة الدراسية، نجح في إقناعي بأن هذه الببتيدات تستحقُّ الدراسةَ فعلًا؛ لذلك عندما اكتُشِفت ببتيدات مماثِلة في جلد الإنسان بعد بضع سنوات، كنتُ مستعدًّا لها.
لقرون طويلة، وصف السكان الأصليون الواسعو المعرفة في كلٍّ من أفريقيا وأمريكا الجنوبية علاجاتٍ مصنوعةً من جلد الضفادع لمقاوَمةِ الكثيرِ من الأمراض، وبوسعنا أن نفهم السببَ الآن. تحتوي جلودُ الضفادع والعلاجيم على مجموعةٍ من العناصر الفعَّالة دوائيًّا، بما في ذلك المضادات الحيوية. وفي نهاية ثمانينيات القرن العشرين، اكتشَفَ فريق مايكل زاسلوف أولَ مضاد حيوي واسع المفعول يتم إنتاجه من مصدر حيواني، وذلك في جلد العُلجوم ذي المخالب «القيطم الأفريقي»، وقد اتضح أنه ببتيد قصير يُسمَّى ماجانين (يعني: الغطاءَ الواقي في اللغة العبرية). وقد كان يُظَن في البداية أن الثدييات، ومن بينها الفئران والبشر، تفتقر إلى هذا الغطاء الواقي.
في الوقت الحاضر، اكتشف العلم مجموعتين من الببتيدات المضادة للبكتيريا موجودتين أيضًا في جلد الثدييات، وهما البيتا ديفينسينات والكاثيليسيدينات. تُنتِج خلايا معيَّنة في الجلد والجهاز المناعي هذه الببتيدات عن طريق قصِّها من بروتينات طليعية أكبر حجمًا، إلا أن الملاحظة التي تفيد بأنها تقتل البكتيريا في أنابيب الاختبار لا تُعتبَر دليلًا دقيقًا على وظيفتها البيولوجية بصفتها مضادًّا حيويًّا في الجلد. أُثبِتَتْ هذه الوظيفة الثانية لأول مرة في عام ????.
ركَّزَ ريتشارد جالو وفريقه بجامعة كاليفورنيا في سان دييجو اهتمامَهم على بروتين موجود في الفئران اسمه «سي آر إيه إم بي» CRAMP، وكان معروفًا بأنه الأكثر شبهًا بالبروتين البشري «إل إل-??» LL-37، وكلاهما ينتمي لعائلة الكاثيليسيدينات. لدراسة دور هذا البروتين في التفاعل الذي يتمُّ بين الفأر والبكتيريا التي يُحتمَل أن تكون ضارة، أجرى الباحثون دراساتٍ متماثِلةً على نحوٍ متناسِق تنطوي على التبديل الجيني للفأر في إحدى التجارب، والبكتيريا في تجربة أخرى. في البداية، استولدوا فئرانًا خالية تمامًا من هذا الجين (مُنتقَصَة جينيًّا)، وعند نمو هذه الفئران في بيئة معقَّمة، فإنها تكون سليمةً ومعافاة، إلا أن هذه الفئران الخالية من بروتين «سي آر إيه إم بي» بعد إصابتها عمدًا بأحد الأشكال الاصطناعية لعدوى المكورات العقدية، تكون إصابتها أخطرَ من إصابة الفئران العادية في المجموعة الضابطة من النمط البري. وفي التجربة المُكملة، أنتج الباحثون بكتيريا مقاوِمة لبروتين «سي آر إيه إم بي»، فوجدوا كما هو متوقَّع أن بكتيريا المكورة العقدية المحوَّرة جينيًّا تتسبَّب في إصابة الفئران الطبيعية بالمرض أكثر من البكتيريا الحسَّاسة لبروتين «سي آر إيه إم بي».
اكتشف باحثون آخَرون مضادًّا حيويًّا ببتيديًّا جديدًا، لا هو ديفينسين ولا هو كاثيليسيدين، ينتجه الجلد أيضًا ولكن ينتهي به المطاف إلى وجوده في العرق؛ حيث بدأ فريق بيرجيت شيتيك من جامعة توبينجين الألمانية بفحص خصائص جينٍ مأخوذٍ من الجينوم البشري، لم يعرفوا وظيفته، وبعدما فحصوا العشرات من الأنسجة البشرية دون أن يعثروا على أيِّ نشاط لهذا الجين، وجدوا أخيرًا أنه مُعبَّر عنه حصريًّا في نوع محدَّد من الغدد العرقية؛ فهو يشفِّر بروتينًا صغيرًا يبلغ طوله ??? أحماض أمينية فقط، وأسماه الباحثون ديرميسيدين. إلا أنهم لم يجدوا في العرق سوى مقطع من الطرف الكربوكسي لهذا البروتين، وهو بقية ببتيدية طولها ?? أطلقوا عليها اسم «دي سي دي-?» DCD-1. قاموا بتخليق نظير «دي سي دي-?»، وفحصوا آثاره البكتيرية مقارَنةً بمقطع الطرف الأميني في الديرميسيدين وببتيدٍ غير ذي صلة، فأثبت نظير «دي سي دي-?» وحده قدرته التدميرية وفاعليته، ليس فقط في مقاومة بكتيريا مثل «الإشريكية القولونية» أو «إنتروكوكس فيكالس»، ولكن أيضًا في مقاومته فطر «كانديدا ألبيكانس» المُعدي الواسع الانتشار؛ مما يوحي بنشاط استثنائي واسع المدى. أظهر النظيرُ هذا النشاطَ في كلٍّ من المحلول المنظم الاختباري المعياري والسائل المصمَّم لمحاكاة التركيب الكيميائي للعرق البشري.
لا تزال تفاصيلُ التركيب الجزيئي والدور البيولوجي للببتيد المأخوذ من العرق قيدَ الاستكشاف، وربما يلعب دورًا في السيطرة على الفلورا الميكروبية الموجودة على بَشرتنا، أو قد يقتصر دوره على حماية الغدد العرقية من غزو الميكروبات الجلدية. عندما يعرف الباحثون تسلسُلَه الجيني، فسوف يتمكَّنون من رصد العناصر ذات الصلة التي ربما لم تُكتشَف حتى الآن. وبالنظر إلى الدور المهم الذي يلعبه الجلد في صدِّ الغزو الميكروبي القادم من العالم الخارجي — ناهيك عن المجهود الذي كرَّسَتْه القدرة الإبداعية للإنسان لكي يظهر هذا الجلد بمظهر جذَّاب وصحي — علينا أن نهتم بأن نفهم جيدًا ما يجري في هذا الشأن.
أحدث التطورات

في عام ????، صمَّم باحثون من إسرائيل نوعًا جديدًا من الببتيدات المصغَّرة المضادة للميكروبات، تجمع بين سمات نوعين مختلفين من مضادات الميكروبات في تصميم بسيط. تحتوي العوامل الجديدة على بقايا أربعة أحماض أمينية فقط، ممتزجةً مع حمض دهني.
صمَّم ياشيل شاي وزملاؤه بمعهد وايزمان في رحوفوت بإسرائيل «ببتيدًا شحميًّا فائق القِصَر» كبديلٍ مُصنَّع لمجموعتين من مضادات الميكروبات الموجودة في الطبيعة، وتحديدًا الببتيدات المضادة للميكروبات «إيه إم بي»، التي تضمُّ عادةً ما بين ?? و?? حمضًا أمينيًّا وتحمل شحنة موجبة صافية، بالإضافة إلى الببتيدات الشحمية التي تجمع بين سلسلة أليفة الشحم وببتيد أنيوني قصير مكوَّن من ست أو سبع بقايا من الحمض الأميني.
عند استكشاف الحد الأدنى من المتطلبات الخاصة بهذه الببتيدات التي لم تزل تعكس نشاطًا مضادًّا للميكروبات، فُوجِئ الباحثون بأنه حتى مع الببتيدات المكوَّنة من أربعة أحماض أمينية فقط، فإنها تُظهِر نشاطًا مقاوِمًا للبكتيريا و/أو الفطريات عند دمجها مع حمض دهني يبلغ طول سلسلته ما بين ?? و?? ذرة كربون. على سبيل المثال، ببتيد تسلسُلُه ليسين-جليسين-جليسين-دي-ليسين، مع حمض الهيكساديكانويك أو النخليك (?? ذرة كربون)، ومرتبط بالطرف الأميني، اتضح أنه المركب الأكثر فاعليةً. وبما أن الرابطة بين الجزء الأليف الشحم والببتيد هي مجرد رابطة ببتيدية أخرى، فيمكن تحضير المركب كله بمُصنِّع ببتيد تجاري باستخدام الإجراءات المعروفة.
على الرغم من صِغَر حجم هذه الجزيئات، قرَّرَ الباحثون تمزيقَ غشاء الخلية بطرقٍ مشابِهة لببتيدات «إيه إم بي» والببتيدات الشحمية الأكبر حجمًا. على سبيل المثال، من خلال امتصاص صبغة فلوروسنت خضراء عبر الغشاء غير النافذ طبيعيًّا يُستدَلُّ على الضرر الذي يصيب الغشاء بسبب الببتيدات الشحمية.
المثير للاهتمام أنه يمكن استخدام كلٍّ من اختيار الأحماض الأمينية وطول السلسلة الشحمية لتحسين نوعية العوامل.
قراءات إضافية

C. L. Bevins and M. Zasloff, Annu. Rev. Biochem., 1990, 59, 395–414.
V. Nizet et al., Nature, 2001, 414, 457.
B. Schittek et al., Nature Immunol., 2001, 2, 1133–1137.
A. Makovitzki, A. Avrahami, and Y. Shai, Proc. Natl. Acad. Sci. USA, 2006, DOl 10.1073/pnas.0606129103.

الفصل السابع
تحذير صحي: قد يكون جسدك غير مستقر


تقول الكتب الأكاديمية إن التطور البيولوجي عبثَ باستقرار بروتيننا البنيوي الأكثر وفرةً، حتى إن درجةَ ذوبانه تزيد عن درجة حرارة الجسم ببضع درجات فقط. وبنظرة أكثر قُرْبًا إلى هذا الموضوع الذي يبدو بسيطًا، سنكتشف أن الكولاجين يذوب في الواقع عند درجة حرارة تقل عن درجة الحرارة الفسيولوجية؛ فهل يجب أن نقلق؟
ثمة مُعتقَد راسخ منذ بداية ظهور البيولوجيا الجزيئية ينصُّ على أن الحالة النَّشِطة بيولوجيًّا لجزيء البروتين تطابِق بنيةً فريدةً مطويَّة على نحوٍ معقَّد في الفراغ، وهي التي تُعرف بالحالة الطبيعية. وإذا دُمِّرت هذه البنية، فإنك تحصل على شيء غير منتظم ومشوَّه ولا فائدة منه، وهو الشريط اللولبي العشوائي (الوشيعة العشوائية)، أو هذا ما ظنَنَّاه. ولكن في نهاية تسعينيات القرن العشرين، اكتشف الباحثون أن الحالةَ غير المطويَّة لا تتسم بهذه العشوائية أو البشاعة على الرغم من هذا، بل يمكن أن تكون لها أيضًا وظيفة بيولوجية. ثمة أعداد متزايدة من البروتينات التي يُعرَف عنها أنها تتحدَّى هذا المُعتقَد الراسخ بسبب وجودها في حالة غير مطويَّة واضحة في الظروف الفسيولوجية. وفي العديد من هذه الحالات، يمكن أن تتخذ هذه الحالة المَرِنة بنيةً ثانية أكثر طيًّا، وذلك بعد مصادَفة لَجين أو جزيء مستقبِل. ويمكن أن تكون التفاعلات بين البروتين واللَّجين أشدَّ صرامةً لو قام البروتين بطيِّ نفسه «حول» اللَّجين مقارَنةً بما لو تقابَلَا بتكامل مفتاحي/قفلي محدَّد مسبقًا.
قد يضطر الباحثون إلى أن يضيفوا إلى هذه القائمة من البروتينات البالغ عددها ??? بروتين تقريبًا، التي من المرجَّح أن تكون غير مطوية تحت ظروف تتوافَق مع بيئتها الفسيولوجية؛ بروتينًا ربما يكون مرشَّحًا غير صالح؛ نظرًا لأنه جزء مهم من الجسم البشري نفسه الذي نودُّ بالطبع أن نفكِّر فيه بصفته مُنظَّمًا وسليمًا وظيفيًّا ومستقرًّا. يمثِّل هذا البروتين، وهو الكولاجين، الذي يشكِّل الأوتارَ والجلدَ وأظفارَ اليد والعديدَ من الروابط البنيوية الأقل ظهورًا في الجسم؛ أكثرَ من ثلث البروتين الموجود لدى الإنسان وبقية الفقاريات الأخرى. ومع هذا، أظهرَتْ دراسة مقيسة حراريًّا ومصمَّمة بحرص شديد، أجراها فريق إس ليكين من مجمع معاهد الصحة الوطنية (بيت حِسْدَا، ماريلاند) أن الحالة المستقرة من الناحية الديناميكية الحرارية التي تتسم بها صورة الكولاجين المأخوذة من رئة الإنسان عند درجة حرارة الجسم الفسيولوجية (?? درجة مئوية)؛ هي الحالة غير المطويَّة.
بصفة أساسية، أدرَكَ الباحثون أن الدراسات السابقة بشأن عملية عدم الطيِّ المُحفَّزة حراريًّا التي يتعرَّض لها الكولاجين قد أُجرِيَتْ بتسخينٍ أسرع من اللازم. وقبل تعديل توازُن عدم الطيِّ البطيء إلى خطوة درجة الحرارة الواحدة، كان الباحثون بالفعل يطبِّقون الخطوة التالية، وبالتالي يحصلون على درجة حرارة متغيِّرة على نحوٍ واضح تفوق القيمةَ الفعليةَ بعدة درجات. اكتشف فريق ليكين أن التغيُّر كان شديدَ البطء لدرجة أنه لم يحقِّق حتى التوازن في الوقت المناسِب عند استخدام أبطأ معدل تسخين ممكن (????? درجة مئوية في الدقيقة)، وقد لجئوا إلى التقدير الاستقرائي لمعرفة درجة الذوبان «الفعلية» للكولاجين في رئة الإنسان، وحدَّدوها بأنها ?? درجة مئوية. إذن، هل نحن جميعًا على شفا انصهار جسدي؟ هل حياتنا مستعارة من شذوذٍ حركي؟
على الرغم من أن بعض الكولاجين الموجود في أجسامنا يُهدَر بالفعل خلال عملية عدم الطيِّ، فإنه لا داعي للقلق كثيرًا بشأن هذا الاكتشاف؛ فبالنسبة إلى هذه البروتينات الرابطة المذكورة سابقًا، التي تكون «غير مطويَّة طبيعيًّا» في المحلول، والتي من الأفضل ربط لجيناتها عند العثور عليها، تَقوى قبضة الكولاجين عندما يجد جزيئاتٍ من نفس نوعه ويشكِّل أليافَ الكولاجين التي تكون من نفس بنية العديد من أنسجة الجسم. وبالتالي، لا يؤثِّر عدم الاستقرار على جزيئات الكولاجين إلا لفترة محدودة تمتد ما بين إفرازها من الخلية وتكوين الألياف الناضجة.
داخل الخلية، يهتمُّ البروتين المقترن المتخصِّص في إنتاج الكولاجين — وهو بروتين الصدمة الحرارية «إتش إس بي ??» Hsp47 — بالمونومرات الطليعية الكولاجين، إلا أن هذه البروتينات بمجرد إفرازها لم تعد بروتينات مقترنة، ويبدو أن استقرارها لا يستفيد إلا قليلًا من وجود التسلسلات الطليعية القصيرة التي تميِّز بين الكولاجين الطليعي (البروتين الطليعي) والكولاجين الناضج. توصَّلَ ليكين وفريقه إلى أنه في هذه المرحلة يجب أن يحدث عدم طيٍّ جزئي، وهو ما يتطابَق مع «عدم الطي المجهري» المفترَض سابقًا كجزءٍ من عملية تجميع ألياف الكولاجين. وبعد التخلُّص من الببتيدات الطليعية، تعمل مرونة السلسلة غير المطويَّة المجهرية على سهولة تكوين الألياف، وكذلك التخلُّص من تلك الجزيئات غير المندمجة التي يجب تكسيرها. المُطَمْئِن في الأمر أن الوضعَ الديناميكي الحراري يتحسَّن كثيرًا بمجرد استقرار جزيئات البروتين بأمان في ألياف الكولاجين. ومع أن عملية فكِّ الطيِّ المجهري قد تظل تحدث بقدرٍ معيَّن وتساهِم في مرونة التركيب، فإن المساحة المحدودة المتاحة لكل جزيء توحي بأن المكسب الإنتروبي الحراري من عملية فك الطيِّ ضعيفٌ، وبالتالي ترتفع نقطة الذوبان. وبشكل إجمالي، فقد عدَّلَ التطوُّرُ البيولوجي توازُنَ المرونة والاستقرار على نحوٍ صحيح تمامًا، مع أن تحقيق هذا التوازن ليس بالبساطة التي اعتدنا أن نتخيَّلَها.
أحدث التطورات

ظهرت شائعات مُبالَغ فيها للغاية بأن انهيارًا بنيويًّا وشيكًا سيصيب جميعَ البشر على كوكب الأرض، وبالطبع لم تثبت صحتها. إلا أن مفهومَ البروتينات غير المطوية في حدِّ ذاتها التي لا تتَّخِذ بنيةً مطويَّةً إلا عند ارتباطها أو في ظل ظروف بيئية معينة؛ قد أثبَتَ فائدته الكبيرة في فهم العديد من الظواهر البيولوجية المتنوعة، التي وُجد لبعضها صلة بالطب.
قراءات إضافية

K. W. Plaxco and M. Gross, Nature, 1997, 386, 657.
V. N. Uversky et al., Prot. Struct. Funct. Genet., 2000, 41, 415.
K. W. Plaxco and M. Gross, Nature Struct. Biol., 2001, 8, 659.
E. Leikina et al., Proc. Natl. Acad. Sci. USA, 2002, 99, 1314.

الفصل الثامن
الجميع معًا الآن


لطالما استمتعتُ بتحدِّي وجهة النظر التقليدية التي تقول بأن البشر هم «أرقى» صور الحياة على كوكب الأرض، وأن كل كائن آخَر مجرد صورة بدائية. على سبيل المثال، البكتيريا ليست بالغباء الذي تبدو عليه؛ إذ تستطيع أعدادٌ هائلة منها تنسيقَ أنشطتها زمنيًّا ومكانيًّا، بالاعتماد على شكل من أشكال التواصل الكيميائي يُعرَف باسم استشعار النِّصاب. فهل هو سلوك اجتماعي لدى البكتيريا؟ يا لها من فكرة مجنونة!
توجد خرافة قديمة ولكنها ما زالَتْ شائعةً تقول بأن سلالة الجنس البشري المعروفة باسم «الإنسان العاقل» تمثِّل أكثر صور الحياة تعقيدًا على كوكب الأرض، في حين أن البكتيريا هي أكثر الصور بدائيةً. ولكن اشتهر دوجلاس أدامز بأنه أسقَطَ الجزءَ الأول من هذه الخرافة، وبدأ علماء البيولوجيا المجهرية الآن يدركون أن البكتيريا أكثر تعقيدًا مما كنَّا نحن البشر الزائلين نعتقد. صحيحٌ أن الأنواع القليلة التي يمكن استزراعها بسهولةٍ داخل المعمل غالبًا ما تُوصَف بافتراض أنها خلية وحيدة مبرمَجة على الانقسام بعد مدة معينة ما توافَرَ طعام كافٍ حولها، إلا أنك لو راقبْتَ البكتيريا في الطبيعة، فستجد أنها أشدُّ تعقيدًا ومليئة بالمفاجآت التي قلَّما يمكن التنبؤ بها.
يقدِّر علماء البيولوجيا المجهرية الآن أن معظم الكتلة الحيوية البكتيرية لا توجد في الحقيقة بصفتها خلايا أحادية تعيش حرَّةً، ولكنها مشتركة في تنظيم أرقى، يتضمَّن التكافُلَ مع الكائنات الحية الأخرى (مثل الأُشنات وأحشاء الحيوانات) والأغشية البيولوجية الرقيقة. يمكن أن تصبح الزَّراقِم جزءًا من الأُشنات، التي تبدو على نحوٍ مخادِع شبيهةً بالنباتات الراقية، وكذلك في البِنى الطبقية التي تعكس تنظيمًا بنيويًّا صارمًا على نطاقات أوسع. وتستطيع مستعمرات البكتيريا المتوهجة إرسالَ ومضاتٍ ضوئية منسَّقة بدقة. تتطلب جميع هذه الأنشطة «الاجتماعية» من كلِّ بكتيريا مفردة أن تستشعر وجودَ البكتيريا الأخرى حولها كي تتواصَلَ معها. وتحقيقًا لهذا الغرض، فإنها تتمتَّع بنظام إشارات كيميائي يُعرَف باسم استشعار النِّصاب (هو نظام تنبيه واستجابة تستخدمه البكتيريا لتنظيم التعبير الجيني لها تبعًا لكثافتها العددية في حيِّزٍ مكاني ما).
اكتُشِف هذا النظام أول ما اكتُشِف في البكتيريا المتوهِّجة التي تلمع فقط عندما يوجد العديد من صديقاتها في الجوار. وفي سبعينيات القرن العشرين، أثبَتَ الباحثون أن هذه البكتيريا تُفرِز رسولًا جزيئيًّا يُسمَّى المحفِّز الذاتي، داخلَ الوسيط، ولا تنتج الضوءَ إلا عندما تستشعر تركيزًا حَديًّا معيَّنًا لهذا الجزيء. طوال سنوات عديدة، اعتقَدَ علماء البيولوجيا أن هذا التواصُلَ يقتصر على التوهُّج البيولوجي، بيد أنه في تسعينيات القرن العشرين اتضح أن استشعار النِّصاب هو ظاهرة أكثر عمومًا، وتنطوي على عمليات مختلفة بما في ذلك تصنيع المضادات الحيوية في بكتيريا «إروينيا كاروتوفورا»، وإنتاج العوامل الخبيثة في البكتيريا المسبِّبة للمرض.
ظلت الآلية الجزيئية لاستشعار النِّصاب غامضةً طوال سنوات. وفي عام ????، استطاع الباحثون بفضل بنيتين بلوريتين للبروتين تشتركان في العملية، أن يفهموا على الأقل بعضَ الجوانب الجوهرية لهذه الآلية. كما تمكَّنَ فريقُ فريدريك هوجسون من جامعة برينستون (نيوجيرسي) من تحديد محفِّز ذاتي لا يزال محيِّرًا حتى الآن اسمه «إيه آي-?» AI-2 عن طريق إذابة البنية البلورية لمُستقبِله، الذي اتضح أنه يحتوي على الجزيء «إيه آي-?». ومع أن العديد من الظواهر البكتيرية المعروفة حتى الآن مختصَّة بنوع واحد، فإنه يبدو أن «إيه آي-?» موزَّع على نطاق واسع، وقد يفيد باعتباره وسيلةَ تواصُلٍ بين الأنواع المختلفة. المُستقبِل المشار إليه هنا هو «إل يو إكس بي» LuxP، وهو بروتين يشترك في التوهُّج البيولوجي المنظَّم للبكتيريا المائية «فيبريو هارفي» (وهي بكتيريا غير ضارة ذات صلةِ قرابةٍ بعيدةٍ بجرثومة الكوليرا، وسُمِّيت باسم رائد أبحاث التوهُّج البيولوجي «إي نيوتن هارفي»). ومع أن بنية البروتين على هذا النحو مشابِهة لبِنى بروتيناتٍ رابطة أخرى موجودة في الحِبْلَة المحيطية بالخلية (وهي المساحة الواقعة بين الغشاء الخلوي والجدار الخلوي)، فإن البنية الكيميائية غير العادية للمحفِّز الذاتي المحبوسة بالداخل، التي تُعتبَر أولَ مثال لجزيء حيوي يحتوي على البورون، كانت هي ما تسبَّب في حفر اسمه على صفحات مجلة «نيتشر». بعد ذلك ببضعة أشهر، قدَّمَ فريق أندريه جوشيماك في معمل أرجون الوطني (أرجون، إلينوي) بنيةً بلوريةً أخرى لبروتين رئيسي يشترك في استشعار النِّصاب. وكان هدف الفريق هو بروتين «تي آر إيه آر» TraR المأخوذ من الجرثومة النباتية المُمرِضة المعروفة باسم الأجرعية المورمة «أجروباكتيريوم تيوميفيشينس». يرتبط هذا البروتين بأحد مستشعرات النِّصاب الأخرى في جهاز التوهُّج البيولوجي، ويشكِّل رابطةً مباشِرةً بين التعرُّف على الفيرومون وبين التغيير الناتج في التعبير الجيني؛ إذ إنه يعمل كمُستقبِل إشارة ومُعزِّز نُسَخ في الوقت نفسه. وقد نجح فريق أرجون في رصده أثناء الحدث، أي في الوقت الذي يرتبط فيه جزيئان من المحفِّز الذاتي بمقطع من الحمض النووي المرتبط بالبروتين المَثْنَوي. من الجوانب اللافتة للنظر في البنية الناتجة أن الفيرومون يبدو مُغلَّفًا بالكامل داخل الطيَّة البروتينية، وطبقًا للأبحاث الكيميائية البيولوجية السابقة، التي تشير إلى أن البروتين يكتسب مقاوَمةً ضد الهضم بالبروتياز عند ربط الجزيء الصغير، فإن هذا الاكتشاف يوحي بأن المستشعِر «يُطوى حول» الجزيء الرسول الخاص به. بعبارة أخرى، يبدأ من بنية ضعيفة الطيِّ، وربما مونومرية، ولا يُطوى ليصبح البروتين المَثْنَوي الرابط بالحمض النووي، إلا عندما يحصل على الجزيئين الخاصين به من المحفِّز الذاتي. وبالتالي، فإن ارتباط جزيء الإشارة هو تحوُّل لا يمكن الرجوع فيه بصفة أساسية من بروتين «تي آر إيه آر» غير النَّشِط إلى البنية النَّشِطة.
وبما أن الأجرعية المورمة «أجروباكتيريوم تيوميفيشينس» تعيش عن طريق اجتياح النباتات وإنشاء مستعمرات في بِنى تبدو كالأورام السرطانية (ومن هنا جاء اسمها)، فسيكون من الضروري بالنسبة إلى كلِّ بكتيريا أن تعرف إنْ كانَتْ جزءًا من قواتِ اجتياحٍ ناجحة، أم أنها ستواجه مصيرها وحدها. ينشط جين «تي آر إيه آر» بمجرد استشعار البكتيريا موادَّ كيميائيةً معينة خاصة بالنبات، فتصبح البكتيريا الواحدة جزءًا من جيش منظَّم منذ تلك اللحظة. ومن المأمول أن يمكِّننا الفهمُ الأعمق للتواصُل البكتيري، بناءً على الدراسات البنيوية الحالية والأبحاث المستقبلية، من محاربة الاجتياحات البكتيرية لأجسامنا بفاعلية؛ نظرًا لأننا من المفترض أن نكون أذكى منها.
(????)
أحدث التطورات

لم ينمُ إلى سمعي رصدُ أيِّ تواصُل بكتيري في السنوات الأخيرة، ولكني متيقِّن من أن أبحاثًا كثيرة مهمة لا تزال تُجرَى في هذا المجال. حاوِلْ زيارةَ موقع استشعار النِّصاب لتعلمَ ما يحدث.
قراءات إضافية

The quorum sensing site: http://www.nottingham.ac.uk/quorum/.
X. Chen et al., Nature, 2002, 415, 545.
R. Zhang et al., Nature, 2002, 417, 971.

الفصل التاسع
أين ذهب معظم الكون؟


لا شيء يضايقني أكثر من صوت الأشخاص الذين يتظاهرون بأنهم يفهمون الكون؛ لأنهم لو كانوا صادقين، لاعترفوا أنه ليست لديهم أدنى فكرة عن ??? من محتوى الكتلة/الطاقة الموجودة في الكون. لقد صاغ علماء الكون مصطلحَي «المادة المظلمة» و«الطاقة المظلمة» ليشيروا إلى تلك الجوانب التي لم يعلموا شيئًا عنها، ولكن هذا أقصى ما توصَّلوا إليه. في عام ????، حضرتُ لقاءً نقاشيًّا في الجمعية المَلكية حول هذا الموضوع، وخرجتُ منه مصدومًا من فداحة جهلنا الشديد.
عندما يحتار المنظِّرون، فإنهم يلجئون أحيانًا إلى مخرَجِ الطوارئ المتمثِّل في افتراض وجود مادة جديدة أو جسيم جديد لا يمكن مشاهدته بالوسائل الحالية. يتضح أحيانًا أنه غير موجود من الأساس (مثل مادة الفلوجيستون الشهيرة)، ولكن في أحيان أخرى يمكن اكتشافه بعد ذلك بعشرات السنين، مثل جسيم النيوترينو الذي قدَّمه فولفجانج باولي على مضضٍ عام ????. وبالمثل، أنتجَتْ مشكلة المادة المظلمة العديدَ من الجسيمات الافتراضية، وفوق هذا كله أقرَّتِ المزيدَ، بما في ذلك جسيم النيوترينو الذي قدَّمه باولي، لإصلاح هذا الثقب العملاق في الكون. وفيما يلي نظرة عامة موجزة لتفسيرات محتمَلة في الماضي والحاضر: لا وجود للمادة المظلمة، والمشاهدات تفسِّرها الديناميكا النيوتونية المعدَّلة. تدَّعِي هذه المدرسة الفكرية (التي يرفضها معظمُ الباحثين في هذا المجال) أن قانون نيوتن للجاذبية قد يختلف عبر المسافات الشاسعة للغاية. على الرغم من أن نظرية الديناميكا النيوتونية المعدَّلة تستطيع أن تفسِّر بضعَ مشاهدات على حساب استبدال قانون نيوتن بمعادلةٍ أقل تميُّزًا، فإنها لا تفسِّر الكون كله بأسلوب منهجي.
«المادة المظلمة الباريونيَّة». مع بداية ظهور أبحاث المادة المظلمة، كان من الممكن اعتبار أن الكتلة المفقودة ربما تحتوي في نهاية المطاف على مادة عادية، ولكنها مختبئة في أماكن غير متوقَّعة، مثل النجوم القِزمة، أو الكواكب، أو السُّحب الغازية. بَيْدَ أنه ظهرت الآن نتائج كثيرة — بما فيها الوفرة النظائرية، وتأثير عدسة الجاذبية، وإشعاع الخلفية الميكروي — تثبت على نحوٍ قاطع أن المادة المظلمة يجب أن تكون في جسيمات غير باريونية. والأهم من ذلك أن المادة الباريونية لن تكون قادرةً على تفسير البِنى الواسعة النطاق (المجرات وما فوقها) التي نراها في الكون.
النيوترينوات. بعد سنوات طويلة من الشك، أثبَتَ الباحثون مؤخَّرًا أن للنيوترينوات كتلةً صغيرة؛ وبالتالي فإنها تستطيع أن تساهِم في المادة المظلمة، خصوصًا لو وُجِدت أنواع أخرى من النيوترينوات منفصلةً عن النيوترينوات الثلاثة المعروفة. وفي هذا السياق، تُعرَف باسم «المادة المظلمة الساخنة». ولكن، حتى الآن لا تستطيع في الغالب المادةُ السوداء الساخنة تفسيرَ بنية الكون.
المادة المظلمة الدافئة، مثل الجرافيتينوات، التي تنشأ بناءً على نظرية التناظُر الفائق كشريك للجرافيتونات، وتُعتبَر حاليًّا من بين التفسيرات غير الواعدة.
تمثِّل الجسيمات الضخمة الضعيفة التفاعل فصيلًا كاملًا من المكونات المحتمَلة للمادة المظلمة الباردة، بما في ذلك النيوترالينوات (المفترَضة بناءً على نظرية التناظر الفائق). وقد أُنشِئت مؤسَّسات عديدة تهدف تحديدًا إلى اكتشافها.
الأكسيونات. دخلت هذه الأكسيونات مجالَ المادة المظلمة عندما تنبَّأت نماذج المحاكاة بأن وفرتها الإجمالية في الكون يجب أن تكون كبيرةً للغاية لو كانت كتلتها صغيرةً بما يكفي، وذلك بناءً على ما افتُرِض في البداية من أنها تسدُّ ثغرةً في النموذج القياسي لفيزياء الجسيمات. وتوجد أيضًا فكرة تجمُّعات الأكسيونات الواسعة النطاق التي قد تُوزَّع على مدار السنوات الضوئية في الفضاء.
الآثار الحرارية الباردة. دون الحاجة إلى تحديد نوع الجسيم الذي تشير إليه هذه النظرية، فإنها تفترض أن المادة الباردة غير المتفاعِلة حاليًّا كانت ذات يومٍ في حالةِ توازُنٍ حراريٍّ مع بقية العالم، وعند مرحلةٍ ما انفصلَتْ واتخذَتْ مساراتها المستقلة. أثبتَتْ هذه النظرية فائدتَها في التنبُّؤ، مع أنها لا تخبرنا بالجسيمات التي تتكوَّن منها المادةُ المظلمة.
ثمة المزيد من الأفكار المحتمَلة، التي توجد بمختلف الأشكال والأحجام. فكما أشار روكي كولب ساخرًا، فإن الكتلة «تحددت في نطاق مقداره ?? درجة أُسيَّة»، وتتراوح سمات التفاعل ما بين عدم التفاعل المطلق (باستثناء الجاذبية الأرضية) والتفاعل الشديد.
كيف يتسنَّى للباحثين فهمُ كلِّ هذا، والتوصُّل إلى التفسير الصحيح من خلال هذا النطاق الواسع من الاحتمالات؟ يأمل البعض أن تتوصَّلَ الفيزياءُ الأساسية ذات يومٍ إلى نظرية شاملة، ستفسِّر — طبقًا للتعريف — الكونَ كله بما في ذلك المادة والطاقة المظلمتان. والأرجح أن الحل سينبع من مزيدٍ من المشاهدات والتجارب، والمزيد من المثابرة والعمل الجاد.
الطاقة المظلمة

تتيح لنا المشاهدات الفلكية رؤيةَ الماضي؛ لأن الضوء المنبعث عن النجوم البعيدة يحتاج إلى ملايين السنين لكي يصل إلى تليسكوباتنا. علاوة على هذا، فإن توزيعَ المادة والإشعاع في الكون يتيح للباحثين تتبُّعَ تطوُّرِها ووصف ما حدث منذ الانفجار العظيم حتى الآن بتفاصيل مقبولة. إلا أنه لا يوجد سبيلٌ لمعرفة مستقبل الكون، وفي الوقت الحاضر تبدو عبارة «ما سيحدث بعد ذلك» أكثر إثارةً للشكِّ من ذي قبل. والمشكلة هي أن مستقبل الكون يعتمد بدرجة حسَّاسة للغاية على طبيعة الطاقة المظلمة.
إن المُعتقَد السابق، الذي ينص على أن الكون تحكمه مادةُ الجاذبية (بغض النظر عمَّا إنْ كانت مظلمة أم مضيئة)، وأنه سوف ينكمش بعد فترة تمدُّدٍ في انسحاق عظيم؛ قد تحطَّم بسبب مشاهدات فلكية بسيطة نسبيًّا اعتمدَتْ على المستعرات العظمى من النوع الأول. وبصفة أساسية، يمكن أن تعمل هذه المستعرات العظمى كإشارة ضوئية؛ لأنها جميعًا متشابِهَة للغاية من حيث كثافتها وخصائصها الطيفية. وبالتالي، بناءً على الضخامة الواضحة التي يظهر بها مستعر أعظمُ بعيدٌ أثناءَ عمليات الرصد، يستطيع علماءُ الفلك استنتاجَ بُعْده من حيث الزمان والمكان. ومن خلال انزياح الطول الموجي إلى اللون الأحمر الذي يتعرَّض له الضوء لدى انتقاله، يستطيعون أن يحسبوا مدى تمدُّد الكون خلال ذلك الوقت.
هذه طريقة بسيطة على نحو مذهل لمراقبة تاريخ تمدُّد الكون. وقد استعان سول بيرلموتر وزملاؤه بهذا المنهج في منتصف تسعينيات القرن العشرين، وهم يتوقَّعون أن يكتشفوا مدى السرعة التي يتباطَأُ بها تمدُّد الكون. ولم يتطلَّبِ الأمرُ أكثرَ من بضعة مستعرات عظمى لإقناعهم بأن افتراضهم الأساسي كان خطأً، وإثبات أن معدل تمدُّد الكون في تزايُدٍ.
بالنظر إلى هذا الرأي وبدمجه مع معرفتنا الحالية بالمادة المظلمة والمادة العادية، وكذلك إشعاع الخلفية الكوني الميكروي، فإنه يقودنا مباشَرةً إلى استنتاجِ أن ثلثَيْ محتوى كتلة/طاقة الكون لا بد حتمًا أنه يسبب تباعد الأشياء بعضها عن بعض بدلًا من أن يجمعها معًا، على غرار ما تفعله مادة الجاذبية. ولكن، لا يخبرنا هذا الرأي مع ذلك بطبيعة هذه الطاقة المظلمة، ولا يخبرنا إن كانت غير متغيِّرة (الثابت الكوني) أو تتغيَّر بمرور الوقت (مثل نظرية الجوهر). إذا كانت طاقةً فراغية ثابتة، فستظهر معضلة أنها يجب أن تختلف شدتها عمَّا يتوقَّعه علماء فيزياء الجسيمات بدرجات أُسيَّة عديدة، علاوة على المصادفة اللافتة المتمثلة في أن مُعَامِلًا تَحدَّدَ عند مولد الكون بقيمة صغيرة للغاية وقتها يجب أن يبدأ في الهيمنة على دراسة الكون في وقت وجودنا تحديدًا بحيث نستطيع رؤية هذا الأمر أثناء حدوثه. من ناحية أخرى، فإن إتاحة الفرصة أمام الطاقة المظلمة لكي تتغيَّرَ بمرور الوقت تثير المزيدَ من التساؤلات والمتغيرات الجديدة التي لا نعرف شيئًا عنها. فهل يمكن تحسين المشاهدات الخاصة بالمستعرات العظمى بحيث تكشف المزيدَ عن غموض الطاقة المظلمة؟
في الوقت الحاضر، تتراكم بسرعة بالغة بياناتٌ عن المستعرات العظمى الموجودة في نطاق شديد البُعْد، وسرعان ما ستوجد المئات منها. عند هذه المرحلة، لن تصبح المعلومات المطلوب جمعها مقيَّدةً بالخطأ الإحصائي، وإنما باحتمالية وقوع خطأ منهجي، فثمة ثلاثة أنواع من الأخطاء الجسيمة التي يجب السيطرة عليها؛ أولًا: مقارَنة المستعرات العظمى التي تنتمي إلى حقب مختلفة على مدار تاريخ الكون تثيرُ احتمالًا بأن الخصائص العادية لهذه الأحداث ربما تغيَّرَتْ بمرور الوقت. على سبيل المثال، عصر الانفجار النجمي أو التركيب الأولي قد يكون مختلفًا عن المستعر الأعظم الجديد العادي، إذا ما قُورِنَ بالمستعر الأعظم القديم العادي. من حسن الحظ أن التحليل الطيفي للضوء الناتج عن المستعرات العظمى يتيح للراصِد تجميعَ صورة كاملة عن خصائصها الفيزيائية، وبعدما يتأكَّد علماء الفلك من أن لديهم أعدادًا كبيرة من المستعرات العظمى محدَّدة الخصائص، ويقارنون فقط الشبيه بالشبيه، فإنهم سيستطيعون استثناءَ أي أثر معاكِس في فروق التوقيت.
ثانيًا: الغبار النجمي الموجود في مسار الضوء قد يشوِّه مشاهدةَ الأحداث البعيدة. للتغلُّب على هذا، يجب أن يُجرِي الراصِد تجارِبَ حاكِمة، كأنْ يتأكَّدَ على سبيل المثال من تشتُّت الضوء المنبعِث عن الأجسام القريبة في أجزاء أخرى من الطيف الضوئي، وتحديدًا مصادر الأشعة السينية. وأخيرًا: قد يتَّسِع نطاق الأحداث البعيدة للغاية على نحوٍ كبيرٍ بفعل تأثير عدسة الجاذبية؛ مما يتطلَّب مشاهدةً دقيقةً للوسط المحيط لتفسير هذه الاحتمالية.
على المدى القصير، سيتناول الباحثون هذه الموضوعات في مشروع واسع النطاق يُسمَّى مصنع المستعر الأعظم القريب، الذي سوف يسجِّل مجموعةَ بياناتٍ كاملة عالية الدقة عن مئات المستعرات العظمى كل عام. وفي محاولةٍ لدراسة ماضي الكون ورصد الوقت الذي تحوَّلَ فيه الكون من البطء إلى التسارُع (أيْ عندما أصبحَتْ للطاقة المظلمة اليدُ العليا بدلًا من مادة الجاذبية)، يعتزم الباحثون تركيبَ تليسكوب ومنظار طيفي في الفضاء خصوصًا لهذه المهمة يُسمَّيَان «إس إن إيه بي» SNAP (أو مِسبار تسارُع المستعر الأعظم). هذا المِسبار، الذي يشترك في استخدامه عددٌ من الفِرق البحثية المتمركزة بصفة أساسية في الولايات المتحدة وفرنسا، سيرصد آلافَ المستعرات العظمى بتفاصيل غير مسبوقة. وعن طريق انتقاء مجموعات جزئية مناسبة من هذا العدد الهائل من المستعرات العظمى، سيتمكَّنُ الباحثون من تقليل حدِّ الخطأ على نحوٍ ملحوظٍ، وبالتالي يقلِّلون نطاق الاحتمالات الموجودة حاليًّا حول طبيعة الطاقة المظلمة ومصير الكون. وبالاستفادة من التقدُّم المتواصِل في مشاهداتٍ تجريبية أخرى، بما في ذلك فحص إشعاع الخلفية الميكروي وكثافة الكتلة وتأثير عدسة الجاذبية، قد يتوصَّلون إلى إجاباتٍ حاسمةٍ لأكثر ألغاز الكون غموضًا.
(????)
أحدث التطورات

ما زالَتِ الأبحاثُ مستمرةً، ولكن حتى نوفمبر من عام ????، لم يزل معظم الكون بلا تفسير.
قراءات إضافية

K. W. Plaxco and M. Gross, Astrobiology: A brief introduction, JHU Press, 2006.

الفصل العاشر
الكروموسوم الذكري مهدَّد بالانقراض


إنها لعنة تطارِد كلَّ ذكرٍ مُفكِّر في جنسنا البشري، أَلَا وهي عدم الصلاحية المفجِع في الكروموسوم الجنسي المحدِّد للنوع. انظر إليه فقط؛ إنه مشوَّه، ويسبِّب المشاكلَ بجميع الطرق، وبالنظر إلى اتجاهات التطوُّرِ البيولوجي، فمن الواضح أنه في طريقه إلى النسيان. وبدلًا من القلق بشأن حجم أعضائنا التناسلية الخارجية، يجب أن نقلق حيال اضمحلال الكروموسوم الذكري «واي». لقد كتب عالِم الوراثة ستيف جونز كتابًا كاملًا عن هذا الأمر، ولكني سأتحرَّى الإيجاز وأَقْنَع بهذا الفصل فقط.
قد يكون الرجال في المتوسط أطولَ قامةً من النساء، وعضلاتهم أقوى، وسياراتهم أكبر، ولكن فيما يتعلَّق بالحمض النووي فإنهم بكل وضوحٍ أدنى منهن. وبدلًا من أن يكون لديهم كروموسوم «إكس» ثانٍ، لديهم فقط كروموسوم «واي» أصغر كثيرًا (انظر الشكل ??-?). وإذا نظرنا فقط إلى المقومات الأساسية للحمض النووي — بغضِّ النظر عن أيِّ معنًى قد تُوحِي أو لا تُوحِي به — فسنجد أن كل خلية في ذَكَرِ الإنسان تفتقر إلى ?? من الحمض النووي الأنثوي، ومن الواضح أن هذه الخسارة لم تعوِّضها إضافةُ ?? من الحمض النووي الذكري العادي. لم يَقْنَع الباحثون قطُّ بنسبةِ الواحد في المائة من الذكورة الوراثية. فعلى الرغم من اكتشافهم العامِلَ الذي يتجه بنمو الجنين نحو الصفات الذكرية (إذ يؤدِّي غيابُه إلى إنتاج إناث، حتى إن وُجِد بقية الكروموسوم «واي»!) وبعض الجينات المرتبطة بالخصوبة الذكرية، فإن عددَ الجينات المتبقية صغير على نحوٍ مذهل. يحتوي معظم الكروموسوم «واي» على مخلَّفات التطوُّر البيولوجي، بما في ذلك تكرارات لا نهائية ونُسَخ غير نَشِطة من الجينات، تُعرَف باسم الجينات الزائفة. والعزاء الوحيد لكبرياء الرجل المجروح هو أن أحدَ كروموسومَيْ «إكس» الموجودين لدى المرأة غير نَشِط إلى حدٍّ كبير. وبالتالي، فإن الفارق الإجمالي في مقدار المادة الوراثية النَّشِطة ليس مأساويًّا إلى هذا الحد.
شكل ??-?: الكروموسومان البشريان إكس (يسارًا) وواي (يمينًا)، بعد تكبيرهما حوالي ?? آلاف مرة.
أدَّتْ نسبة التكرارات الكبيرة إلى جعل تحديد تسلسُلِ الكروموسوم «واي» أكثرَ صعوبةً مقارَنةً ببقية الجينوم البشري. وقد أثبتَتْ طريقةُ التسلسُل النووي القسري — التي تنطوي على قصِّ المادة الوراثية إلى مقاطع عشوائية، وترتيب تسلسُلِها النووي، ليجمع الكمبيوتر هذه المقاطِعَ في النهاية — فاعليتَها الشديدةَ في العديد من مشروعات الجينوم، ولكنها تفشل عندما يتسبَّب وجود تكراراتٍ أكثر من اللازم في حدوث ارتباكٍ. كما أن الطريقةَ التقليدية، التي تعتمد على رسم خريطة للجينات أولًا، ثم ترتيب تسلسُلِها النووي لاحقًا، لا يمكنها هي أيضًا حلُّ هذه المشكلة.
لهذا السبب كان على الباحثين في ثلاثة معامل في هولندا والولايات المتحدة، بقيادة ديفيد بيدج من معهد ماساتشوستس للتكنولوجيا، وَضْعُ استراتيجيةٍ جديدة تمامًا للتعامُل مع الجزء الكثير التكرار في الكروموسوم «واي»، الذي أهمَلَه مشروعَا الجينوم البشري كلاهما. بدءوا بتحليل الكروموسوم «واي» لرجل واحد، حيث أخضعوه لدورات متكرِّرة من رسم الخرائط وترتيب التسلسل النووي، ومع أن العديد من الباحثين قد حذَّروا من أن محتويات الكروموسوم قد لا تستحِقُّ هذا المجهودَ، فقد توصَّلوا إلى معلوماتٍ مثيرةٍ وتنويرية بشأن تطوُّرِ الجنسين.
ذات يومٍ، منذ وقت بعيد، ومع بداية تطوُّر الثدييات، كان الكروموسومان «إكس» و«واي» زوجًا متطابِقًا عاديًّا من الكروموسومات. ومثلما يحدث مع بقية أزواج الكروموسومات الاثنين والعشرين الأخرى في الجينوم البشري (المسمَّاة «الكروموسومات الجسدية»، وذلك تمييزًا لها عن الكروموسومات الجنسية)، كانت لهذه الكروموسومات العتيقة القدرةُ على استبدال مقاطع من الحمض النووي من خلال عمليةٍ تُعرَف باسم «التبادُلِ الكروموسومي». تتضمَّن هذه الظاهرة إمكانيةَ المزج بين جين الأب وجين الأم في الذرية، دون أن يهدِّد ذلك ثباتَ محتويات كروموسومٍ معيَّنٍ. وحسبما سنرى بعد قليل، توضِّح الحالةُ المُزرية التي وصَلَ إليها الكروموسوم «واي» ما يحدث عندما يتوقَّفُ التبادُلُ الكروموسومي.
في الوقت الحالي، لا يزال جزء صغير للغاية من الكروموسوم «واي» مشتركًا في التبادُل الكروموسومي مع الكروموسوم «إكس». يُعرَف هذا الجزء من الكروموسوم بأنه الجزء الكروموسومي الجسدي الزائف؛ لأن الكروموسومين «إكس» و«واي» يتصرَّفان هناك وكأنهما كروموسومان جسديان. إلا أنَّ الأجزاء الشديدة التكرار والصعبة التسلسُل التي شكَّلَتْ تحدِّيًا بالنسبة إلى الباحثين تمثِّل الوجهَ الآخَرَ من الكروموسوم «واي»، وهي غير قادرة على الاشتراك في التبادُل الكروموسومي، كما أنها تشكِّل ??? من طول الكروموسوم، وكان يشار إليها بأنها المنطقة غير المُطَعمة، حيث يُقصَد ? «التطعيم» عمليات تبادُل الحمض النووي، مثل التبادُل الكروموسومي. وبعدما اكتشف بيدج وزملاؤه أن هذه المناطق قد تُطعم في الواقع بطرق أخرى، اقترحوا بدلًا من ذلك تسميتها بمنطقة التخصُّص الذكري.
تكشف التسلسُلات التي حدَّدَها بيدج وزملاؤه عام ???? أن الجزءَ النَّشِط من الحمض النووي الموجود في منطقة التخصُّص الذكري عبارة عن فسيفساء تجمع بين ثلاثة أنواع شديدة الاختلاف من المادة الوراثية. يُعتبَر النوع الأسهل عند التعرُّف عليه هو تسلسلات الإكس المنقولة، التي لا تحتوي إلا على جينين اثنين فقط من الثمانية وسبعين جينًا الموجودة في منطقة التخصص الذكري. من الواضح أن هذين الجينين قد نُقِلَا من الكروموسوم «إكس» خلال حدَثٍ واحد يبدو أنه قد تمَّ منذ أربعة ملايين سنة، عقب افتراق أسلافنا عن أسلاف القردة مباشرة، وهما أحدث مهاجرين في منطقة التخصُّص الذكري، وقد وُجِدَا في الكروموسوم «واي» البشري فقط.
إن «أقدم» الجينات في منطقة التخصُّص الذكري، أي الجينات التي انفصلَتْ نتيجةَ التبادل الكروموسومي مع الكروموسوم «إكس» لفترةٍ طويلةٍ، وبالتالي أُتِيحت لها فرصةٌ كبيرة لتُطوِّر الخصائصَ الوراثية الذكرية العادية؛ قد تجمَّعَتْ في مجموعة ثانية، أطلَقَ عليها بيدج وزملاؤه اسمَ الجين المتفسِّخ «إكس». تحتوي هذه المجموعة على ?? جينًا عاملًا، بما في ذلك عامِل تحديد الجنس SRY. علاوة على ذلك، توجد ?? نسخة غير نَشِطة من الجينات، يُشَار إليها باسم الجينات الزائفة. ترتبط جميعُ تسلسُلاتِ الحمض النووي التسعة والعشرين ارتباطًا واضحًا بالأجزاء المقابِلة من الكروموسوم «إكس»، وبناءً على درجة الاختلاف التي تظهرها الآن، استنتج الباحثون أن هذه التسلسلات كانت جيناتٍ لكروموسومات جسدية عادية حتى المرحلة التي توقَّفَ عندها التبادُل الكروموسومي — منذ حوالي ??? مليون سنة — وبدأت الجينات تنحرِف عن نظرائها على الكروموسوم «إكس». تعمل درجة الانحراف المغايرة في الأجزاء المختلفة من الكروموسوم «واي» ? «ساعة جزيئية» تساعد الباحثين في استنتاج إطارٍ زمنيٍّ يوضِّح كيفيةَ انفصال الكروموسومَيْن «إكس» و«واي» شيئًا فشيئًا، وهو في الواقع عملية انفصال بطيئة للغاية على مدًى زمنيٍّ طويلٍ. ثمة حقيقة تقول: إن مقدار النصف تقريبًا من جينات الكروموسومات الجسدية التسعة والعشرين — التي كانت موجودةً في هذه المجموعة في بداية تطوُّرِ الثدييات — قد فقدَتْ وظيفتَها وتحوَّلَتْ إلى جينات زائفة. وتعكس هذه الحقيقة مشكلةً فعليةً متأصِّلةً في الطريقة التي نعامِل بها نحن الثدييات كروموسوماتنا الجنسية. ومع أن التبادُلَ الكروموسومي في الكروموسومات الجسدية، وفي الزوجين «إكس إكس»، وفي الأجزاء الكروموسومية الجسدية الزائفة للزوجين «إكس واي» يضمن تحقُّقَ بعض الاستقرار الجيني، فإن منطقة التخصُّص الذكري مُستثَناة من هذه الآلية الاستقرارية. وبطريقةٍ ما، كان من سبيل المفارَقةِ الشديدة أن ينتقلَ جزءُ تحديد الجنس في الجينوم البشري بطريقةٍ لا تزاوجيةٍ، فقط من الأب إلى ابنه. ويحمل هذا النوع من الوراثة مخاطَرةً تتعلَّق بتراكُمِ الطفرات الخطيرة.
ومع هذا، فثمة طريقة يحاوِل بها التطوُّرُ البيولوجي مقاوَمةَ هذه المخاطَرةِ، وقد اكتشَفَ الباحثون هذا الأمر في المجموعةِ الثالثة من تسلسُلات الحمض النووي، المسمَّاة بالتسلسُلات المُضخَّمة. والتسلسُل المُضخَّم عبارة عن مقطع من الحمض النووي تم تكبيره؛ مما يعني أن نُسَخًا متعدِّدة تُصنَّع منه (في المعمل، يُعتبَر تفاعُل البوليمريز المتسلسِل وسيلةً شائعة لتضخيم الجين). وتعدُّدُ النُّسَخ هو في الحقيقة ما تُجِيدُ منطقةُ التخصُّص الذكري عملَه. وبوجود عشرة ملايين قاعدة، يصبح الحمضُ النووي المُضخَّم هو الأكبر بين هذه المجموعات الثلاث، وهو يحتوي على تِسْع عائلات من الجينات النَّشِطة (أيْ تسعة جينات مختلفة والكثير من النُّسَخ والصور منها)، وكلها تنشط غالبًا أو حتى حصريًّا في الخصيتين، وبالتالي يُفترَض أن لها علاقةً بالجنس والتكاثُر.
توجد أجزاء كبيرة من هذه التسلسلات بصفتها تتابُعاتٍ متناظِرةً؛ مما يعني أن شريطًا معيَّنًا من حروف الحمض النووي تعقبه فورًا صورة منعكسة لهذا الشريط في الجديلة المقابلة. على سبيل المثال:
TATATCTCGAGATATAATATAGAGCTCTATAT
(لاحِظْ أنه بسبب التكامُل القاعدي، ستجد تتابُعاتٍ متناظِرةً أيًّا كان الشريط الذي تبدأ بقراءته.) ويتكوَّن أطولُ تتابُعٍ متناظِرٍ من هذا النوع من ??? مليون قاعدة، ويحتوي على تتابُعين متناظِرين أصغر داخلَ تسلسُلِه. ويتبين أن جزءًا كبيرًا من الكروموسوم «واي» مليء بالتتابعات المنعكسة على نحو محير.
الجينات في هذه الصور المنعكسة ذات أصولٍ مختلفة. في تسعينيات القرن العشرين، اكتشف بيدج وآخَرون أن فقدان مجموعة واحدة من هذه الجينات يجعل الرجل عقيمًا، وتُعرَف المنطقةُ التي توجد بها هذه الجينات باسم عامِل فَقْدِ النِّطاف. وحسبما يبدو، فقد خَصَّصَ التطوُّرُ البيولوجي بمرور الوقت هذه الجيناتِ وغيرَها من جينات التكاثُر لمنطقةِ عامِل فَقْدِ النِّطاف. هذا هو المثال الوحيد المعروف لكروموسومٍ تَخصَّصَ في وظيفةٍ من نوع معيَّن، و«يجمع» الجينات المرتبطة به. وفي بقية الكروموسومات الأخرى، يكون ترتيبُ الجينات عشوائيًّا على نحو تقريبي.
عندما تأمَّلَ الباحثون عن كثبٍ التعدُّديةَ المحيِّرةَ التي تتسم بها النُّسَخُ والصور المنعكسة، توصَّلوا إلى حلٍّ مدهش للمشكلات التي تسبَّبَ فيها غياب التبادُل الكروموسومي، مثلما أوضحنا من قبل. ومن الواضح الآن أن الصورَ المنعكسة تكون بمنزلة نُسَخٍ احتياطية، وتتبادل رفقاءها بطرق مماثلة لما يحدث مع النُّسَخ الموجودة على الكروموسوم الآخَر في حالة الكروموسومات الجسدية. وحيث إن التبادُلَ الكروموسومي مع الكروموسوم «إكس» قد أصبَحَ مستحيلًا، يلجأ الكروموسوم «واي» إلى التبادُل الكروموسومي مع نفسه، وكانت هذه المساعدة الذاتية تتمُّ منذ ملايين السنين، حسبما اكتشَفَ بيدج وزملاؤه عن طريق فحص الكروموسوم «واي» في الشمبانزي؛ مما يعني أن أقربَ الكائنات الحية شبهًا بنا تشترك معنا في ستةٍ من ثمانية تتابُعاتٍ متناظِرة كبيرة.
سيحتاج الباحثون إلى مزيدٍ من المعلومات عن عددٍ أكبرَ من الكروموسومات الجنسية في الثدييات ليحدِّدوا بدقةٍ كيفيةَ انحراف الكروموسومين «إكس» و«واي» وأسبابه. وتكشف المقارَنات مع أنواع مثل الطيور والنحل، بل وفي واقع الأمر خُلد الماء (انظر مقال «الطيور والنحل وخُلد الماء»)؛ أن هناك طرقًا عديدة لتحديد الجنس، وبالتالي فإن انهيار الكروموسوم الجنسي الذي نحمله نحن ذكور البشر، كان بلا شكٍّ نتيجةً حتميةً. ومع هذا، فقد نجحوا حتى الآن في أن يُثبِتوا أن الانعكاسات والتكرارات اللانهائية لا يُشترَط فيها أن تكون عديمة الفائدة ومملة.
(????)
أحدث التطورات

شهد عام ???? ظهورَ علم الجينوم الشخصي. وكما هو متوقَّع، فإن أول مَن خضعا للتسلسل الجينومي كانا من الرجال، وتحديدًا جيمس واطسون وكريج فينتر. لذا، بالإضافة إلى جميع المعلومات المتاحة عن الرجال عمومًا، يمكننا أن نتطلَّع إلى تفاصيل أكثر عن جينوم رجالٍ بأعينهم (من المرجَّح أن يكونوا عظماء).
قراءات إضافية

H. Skaletsky et al., Nature, 2003, 423, 825.
S. Rozen et al., Nature, 2003, 423, 873.
S. Jones, Y: The descent of men, 2003.

الفصل الحادي عشر
ألعاب الحمض النووي


أتاحَتْ لنا أدوات البيولوجيا الجزيئية الفرصةَ لقراءة الحمض النووي، ولكنها تمكِّن العلماء أيضًا من تصنيع الحمض النووي والتلاعُب فيه. وقد بدأ مجال تكنولوجيا النانو للحمض النووي كتطبيقٍ غير تقليدي إلى حدٍّ ما لفكرة التفكير خارج الصندوق، ولهذا ضمَمْتُه إلى جزء «كائنات غريبة». ولكن بعد بضع سنوات، أصبحت ألعاب الحمض النووي الصناعي أدواتٍ مفيدةً للغاية؛ ولهذا سنتناول هذا المجال مجدَّدًا بمزيدٍ من التفاصيل في جزء التكنولوجيا الرائعة، مع أن ألعاب الحمض النووي رائعة أيضًا.
عادةً ما تترك الخلية مهامَّ بناءِ البِنى المعقدة وتنفيذ المعالجات الكيميائية الدقيقة للبروتينات المتخصِّصة. وقد يبدو الحمض النووي، بالمقارنة بها، مجرد جزيء مملٍّ ذي أربع وحدات بنائية مختلفة، وتتمثَّل وظيفةُ تركيبه الدقيق بصفةٍ أساسية في توفير المساحة.
مع أن الحمض النووي في الخلية يؤدِّي غرضًا واحدًا فقط، فإن هذا لا يلغي استخدامَ مكوناته الأساسية ومبادئ تصميمه في بناء أشياء أخرى. تتمثَّل إحدى أهم مزايا هذا البوليمر البيولوجي في أن أدوات البيولوجيا الجزيئية الحديثة تُمكِّن العلماءَ من التعامُل معه بكفاءةٍ غير مسبوقة. على سبيل المثال، يزوِّدنا تفاعُلُ البوليمريز المتسلسل بوسيلةٍ لتسريع نَسْخ أيِّ تسلسل حمض نووي، بينما تتيح إنزيمات القطع حدوثَ تعديل عالي التخصُّص للجزيئات.
أدرك نادريان سيمان بجامعة نيويورك أن هذه الظروف هي الظروف المثالية لاستخدام الحمض النووي كمادة بنائية. لذا، في عام ????، شرع هو وزميله يونجوي تشين في تصميم وإنتاج مكعب من الحمض النووي بمقياس النانو، على أن يُغلَّف كلُّ سطح من أسطح المكعب الستة بجزيء حمض نووي حلقي الشكل يحتوي على ?? نيوكليوتيدة؛ أيْ ?? على كل جانب. وبالتالي، فإن كلًّا من حوافِّ المكعب الاثنتي عشرة ستتكوَّن من لولب مزدوج يحتوي على ?? زوجًا قاعديًّا، يتوافق بالضبط مع لفتين لولبيتين. وعند كل زاوية من الزوايا الثماني، تلتقي ثلاثة لوالب مزدوجة لتبادُل الأزواج (انظر الشكل ??-?). شكل ??-?: كيفية بناء مكعب من الحمض النووي. كل وجه من أوجه المكعب تحدِّده حلقة من الحمض النووي، وكل حافة يحدِّدها تتابُعٌ، حيث تشكِّل الحلقتان المتجاورتان لولبًا مزدوجًا.
بدءًا من عشرة جزيئات من الحمض النووي الأحادي الجديلة المفتوح السلسلة، كان الباحثون يحتاجون بصفة أساسية إلى خمس خطوات تتضمَّن الحلقنةَ وتكوينَ الجدائل المزدوجة والدمجَ والتنقيةَ وصولًا إلى المنتَج النهائي. وباستخدام وسائل تحليلية تعتمد على إمكانية وصول إنزيمات القطع إلى الجدائل، استطاعوا أن يُثبِتوا أن التركيب يتمتَّع بالطوبولوجيا الصحيحة المطلوبة لمكعب حمض نووي من تصميمهم الخاص. وهذا يعني أن الجديلتين ملفوفتان إحداهما حول الأخرى، والحلقات متشابكةٌ بالطريقة الطوبولوجية المطلوبة تمامًا، ولكن لإثبات أن البنية تتمتَّع فعلًا بزوايا قائمة وأضلاع مستوية كالمكعب، سيكون عليهم انتظار تحديد البنية الفعلية؛ مما سيتطلَّب مادةً أكبر بعدة قيم أسية مما تمَّ إنتاجه في العرض الأول، وقد استعان تشين وسيمان بطريقة الكاشِف المُشِعِّ لتحليل بِنى الحمض النووي.
إلا أن هذه المشكلة لم تمنع سيمان من المضي قدمًا في إنتاج بِنًى أكثر تعقيدًا عن طريق الحمض النووي. وبالتعاون مع واي دبليو زانج، نشر سيمان عام ???? بنية مجسَّمٍ ثمانيٍّ مبتور (اضْمُمْ هرمين رباعيين معًا عن طريق قاعدتيهما، ثم اقطع جميع الزوايا الست)، تكوَّنَتْ حوافه أيضًا من ?? زوجًا قاعديًّا. في المُجمَل، احتوى منتَج الحمض النووي الجديد هذا على ???? نيوكليوتيدة، يبلغ وزنها الجزيئي ??? ألف دالتون. يتوافق هذا الحجم مع المركبات البروتينية الطبيعية الكبيرة، مثل البروتين المقترن «جي آر أوه إي إل» GroEL والبروتيسوم. حتى هذا الجزيء الفائق يحتوي على أطراف مفكَّكة؛ مما قد يفيد مستقبلًا في بناء شبكات مسامية لا نهائية مشابِهة للزيوليت غير العضوي. فيما بعدُ، أصبح سيمان مهتمًّا أيضًا بالعُقَد الجزيئية كتلك التي ناقشناها في مقال «الأسباراجين والشريط القديم»، وعندما تعامَلَ مع هذا التحدي بأسلوبه، نجح في الحصول على عقدة ثلاثية من الحمض النووي، وحصل مؤخرًا (بالتحديد عام ????) على حلقات بورومين، وهي مجموعة من ثلاث حلقات أو أكثر متشابِكة على نحوٍ سيؤدِّي معه قطعُ إحداها إلى تحريرها جميعًا.
بعيدًا عن كون بِنى الحمض النووي بمنزلة ألعاب مدهشة للكيميائيين، فإن تلك البِنى التي أنتجها سيمان في معمله قد تكون لها تطبيقات في تقنيات المستقبل. مع أن الحمض النووي مادة مُكلِّفة إلى حدٍّ ما، ولا تزال تفاصيله البنيوية واستقراره بحاجةٍ إلى إثبات، فإن الوصول المنقطع النظير إلى أشكالٍ وشبكاتٍ جوفاء محدَّدة ونانوية سيضمن للحمض النووي مكانًا على القائمة القصيرة عندما يتعلَّق الأمرُ باختيار المقومات الأساسية لتكنولوجيا المستقبل. وقد تتضمَّن التطبيقاتُ المحتمَلة وظائفَ ناقلة وداعمة، بل تحفيزية أيضًا.
إلا أن الخواص البنائية الميكانيكية للحمض النووي ليست وحدها ما أثارَ اهتمامَ الكيميائيين خلال تسعينيات القرن العشرين؛ فقد اتضح أيضًا أن الجزء الداخلي من اللولب المزدوج عبارة عن سلك شديد الفاعلية بالنسبة إلى الإلكترونات. وفي عام ????، اكتشفَتْ جاكي بارتون وفريقها في معهد كاليفورنيا للتكنولوجيا أن سرعة انتقال الإلكترون عبر قواعد الحمض النووي العطرية المكدسة في منتصف اللولب المزدوج مثل السلم الحلزوني، هي سرعة فائقة مقارَنةً بأنظمة بيولوجية أخرى. كانت السرعات التي أوردَتْها بالفعل مرتفعةً للغاية، لدرجة أن كثيرين لم يصدِّقوها. ولكن في عام ????، توصَّلَ توماس ميد وجون كايم — اللذان يعملان بدورهما في معهد كاليفورنيا للتكنولوجيا، ولكنهما يستخدمان أساليبَ مختلفة — إلى نتيجة مماثلة من الناحية النوعية بأرقام أدنى بعض الشيء، ونجَحَا في إقناع المُشكِّكين.
استخدَمَا في تجربتهما مركبات عضوية فلزية تضمُّ فلز الروثينيوم الثقيل، وذلك من أجل الباعِث والمستقبِل للتيار السريع. يمكن تنشيط الباعث بوميض من ضوء الليزر، ويمكن بسهولة ملاحظة وصول الإلكترون إلى المستقبِل وهو يغيِّر الخواص المطيافية للجزيء. من المحتمَل أن يكون البناء المعقَّد لمركب الروثينيوم الأول — الذي يجب أن تمرَّ عبره الإلكتروناتُ قبل أن تصل إلى «طريق الإلكترونات» في منتصف اللولب المزدوج — هو السبب وراء بطء الانتقال مقارَنةً بما حدث في تجربة بارتون. تعتقد جاكي بارتون أن تجربتها، التي تحرَّرَ فيها الإلكترونُ في «طريق الإلكترونات» مباشَرةً، قد قاست السرعةَ الحقيقية لانتقال الإلكترون في الحمض النووي.
من النتائج المهمة التي تمخضَتْ عنها هذه الدراساتُ اكتشافُ أن «سلك» الحمض النووي يعمل في اللوالب المزدوجة فقط. وحتى عندما يرتبط الباعث والمستقبِل بنفس جديلة الحمض النووي، فإن وجود الجديلة الثانية المكمِّلة ضروريٌّ بلا شك من أجل تدفُّق الإلكترونات؛ مما يفتح المجال أمام تطوير مسابير متخصِّصة وعالية الحساسية من أجل رصد تسلسلات معينة من تسلسلات الحمض النووي. ولكي يتأكَّد المرء من وجود تسلسل حمض نووي محدَّد، بإمكانه تخليق الجديلة المكمِّلة، ودمجها مع المركبات المناسبة، ثم استخدام التحليل المطيافي ذي النقل الإلكتروني السريع من أجل رصد وجود التسلسل محل الاهتمام.
لن يحل الحمض النووي محل الأسلاك فقط، بل سيكون بوسعه أيضًا في يومٍ من الأيام أن يتفوَّق على أجهزة الكمبيوتر الإلكترونية. في نوفمبر ????، ذكر ليونارد أدليمان من جامعة جنوب كاليفورنيا في لوس أنجلوس أنه قد بنى نوعًا من «الكمبيوتر الكيميائي» باستخدام الحمض النووي. وتُعتبَر المشكلةُ الأولى التي حلَّها بواسطته مثالًا بسيطًا لمشكلة «البائع المتنقِّل» التي تكمن في التوصُّل إلى أقصر طريق يربط بين عدد من المدن. ومثل الكمبيوتر التقليدي المعتمِد على السليكون، يستطيع الحمض النووي تخزينَ المعلومات في حالة مُشفَّرة، وباستخدام وسائل البيولوجيا الجزيئية، يستطيع المرء قراءة مجموعات البيانات المشفَّرة هذه أو نسخها أو فرزها. وبالطبع، تستغرق كلُّ خطوة من هذه الخطوات وقتًا أطول في نظام الحمض النووي مقارَنةً بشريحة السليكون، ولكن يمكن تعويض هذا الأمر بالميزة المتمثِّلة في إمكانية احتواء أنبوب التفاعل بسهولة على ???? جدائل حمض نووي مختلفة، والتي تمثِّل أكبر عدد من مجموعات البيانات المختلفة. اقترح ريتشارد ليبتون من جامعة برينستون في عام ???? أن هذا التشابه الهائل سيتيح لكمبيوتر الحمض النووي حلَّ مشكلاتٍ تُعتبَر «عويصةً» بالنسبة إلى أجهزة الكمبيوتر التقليدية. نجح هذا التخمين في إفاقة علماء الكمبيوتر الذين لم يكونوا منبهرين إلا بعض الشيء بكمبيوتر البيولوجيا الجزيئية لأدلِمان. التشابه هو أهم موضوع في مستقبل الحوسبة، والوسائلُ غير التقليدية التي تهدف إلى تحقيق هذا قد تسطِّر نهايةَ رقائق السليكون في يومٍ من الأيام.
(????)
أحدث التطورات

مع أن الحمض النووي لا يزال مجالًا محدودًا، فإن «سوء استخدامه» كان يطرح باستمرار اكتشافاتٍ جديدةً ومثيرةً في تسعينيات القرن العشرين ومطلع القرن الحادي والعشرين. اقرأ الجزءَ الواردَ تحت عنوان «تكنولوجيا رائعة»، الذي يطرح تطبيقاتٍ رائعةً وغير تقليدية لبِنى الحمض النووي.
قراءات إضافية

M. Gross, Travels to the Nanoworld, Perseus, 1999.

الفصل الثاني عشر
إعادة إحياء بروتين عمره مليار سنة


من الشائع اليوم أن يستنتج علماء الوراثة التكوينَ الوراثي لسلف مشترك، ذلك الذي اشترك فيه جينان أو حتى جينومان؛ وأعني بذلك آخِرَ سلف مشترك بين سلالتين مختلفتين موجودتين اليوم. وبناءً على ذلك، فإن إعادة تكوين السلف المشترك اعتمادًا على المعلومات الوراثية المُستنتَجة تُعتبَر خطوةً منطقيةً، ولكنها أيضًا مجنونة بعض الشيء. في الوقت الحالي، سيكون ذلك صعبَ الحدوث إلى حدٍّ ما بالنسبة إلى كائنات حية بأكملها، ولكن يمكن عمله بالنسبة إلى جينات فردية، والبروتينات الناتجة عنها، حتى لو وُجِد ذلك السلف المشترك منذ مليار سنة مضَتْ.
ركَّزَتِ الأساليبُ الجزيئية للتطوُّر البيولوجي وعلم تطوُّر السلالات على التسلسلات الجينية في المقام الأول. وبناءً على الاختلافات الموجودة بين صور جينات اليوم، يستطيع الباحثون استنتاجَ الوقتِ الذي عاش فيه السلف المشترك، ورَسْمَ شجرةِ عائلة تطوُّرية بدقة متناهية.
ولكن لماذا نتوقَّف عند هذا الحد؟ إذا استطاع المرء الاستنتاجَ بناءً على الجينات العتيقة، فإنه يمكنه أيضًا التعبيرُ عن تلك الجينات وإنتاج بروتيناتٍ عتيقةٍ لدراسة الحياة مثلما كانت منذ ملايين السنين. جرَّبَ ستيفن بينير وزملاؤه بجامعة فلوريدا في جينسفيل هذا الأسلوبَ لأول مرة من أجل إعادة بناء الإنزيمات الهاضِمة التي كانت موجودةً في ذلك الوقت، الذي طوَّرَتْ فيه المُجْتَرَّاتُ مَعِدةً إضافية. ثم في عام ????، زاد بينير توغُّلًا في هذا النوع من البيولوجيا الإحيائية وصولًا إلى تاريخ الحياة البدائية، بهدف «إعادة إحياء» جزيئات البروتين التي شُوهِدت لآخِر مرة في عصر ما قبل الكمبري؛ أي منذ أكثر من مليار سنة.
وعلى وجه التحديد، عالج بينير وزملاؤه المسألةَ المتعلِّقةَ بنطاق درجة الحرارة الذي تأقلَمَ معه آخِر سلف مشترك بين جميع السلالات البكتيرية. وقد أُثِير كثيرٌ من الجدل حول هذا الشأن؛ إذ إن بعضَ أقدم فروع شجرة العائلة البكتيرية تقودنا إلى سلالات شديدة التأقلم مع الحرارة. حلَّلَ الباحثون تسلسلاتِ أحد البروتينات المُساعِدة خلال عملية التخليق البيولوجي للبروتين، وهو عامل الاستطالة «إي إف-تي يو» EF-Tu. ومثلما يوحي الاسم (Tu إشارة إلى عدم الاستقرار الحراري Temperature-unstable)، يستجيب هذا البروتين بحساسية شديدة لتغيُّرات درجة الحرارة، ويتأقلم مع درجة الحرارة المُثلى للنمو في جميع الكائنات التي خضعت للدراسة. وبناءً على الاختلافات في التسلسلات الحالية، نجح فريق بينير في الرجوع بالزمن إلى الوراء لاستنتاج تسلسُل «إي إف-تي يو» الموروث الذي تطوَّرَتْ منه. كما نجحوا في التعبيرِ عن هذا البروتين الذي يبلغ عمره مليارَ سنة في البكتيريا الحديثة، ودراسةِ وظيفته في درجات حرارة متفاوتة. وكذلك كرَّروا هذا الإجراء بناءً على تفسيرات بديلة لشجرة العائلة، وقد أظهرَتْ جميع البروتينات العتيقة الناتجة درجةَ الحرارة المُثلَى في نطاق متأقلم حراريًّا (ولكن دون إفراط) يتراوح بين ?? و?? درجة مئوية.
(????)
أحدث التطورات

واصَلَ بينير وآخَرون إعادةَ إحياء تسلسلات بروتينية عتيقة، وتحليلَ العلاقات التطورية بناءً على هذا الأساس.
قراءات إضافية

E. A. Gaucher et al., Nature, 2003, 425, 285.
David A. Liberles, ed., Ancestral Sequence Reconstruction, Oxford University Press, 2007.

الفصل الثالث عشر
لا تُوقِفني الآن!


أحيانًا أقرأ عن أمورٍ في المطبوعات العلمية تبدو غريبة لدرجةٍ يستحيل معها تصديقها؛ فأتوقَّف لحظةً وأرجع إلى الغلاف. أجل، إنها فعلًا مجلة «نيتشر»، وهذا ليس عدد الأول من أبريل (أي إنها ليست كذبة أبريل)، ولست أحلم أيضًا. إحدى هذه الحالات كانت عبارة عن ثلاثة أبحاث ظهرت عام ????، تصف كيف أدَّى التطور البيولوجي إلى طرح أنظمة شديدة التعقيد تتتبع إنزيمًا ناسخًا جامحًا وتُوقِف عمله. لا بد أن هذا أمر غير مُختلق. وبالنسبة إليَّ، تُعتبَر بالطبع هذه الموضوعات الغريبة مبررًا يدفعني إلى الجنون بعض الشيء أنا أيضًا …
من الجيد دائمًا أن تعرف متى تتوقَّف؛ فلو كنتُ أنا — مثلًا — أنوي الاستفاضة في الجملة السابقة، حتى بعد أن أوضحتُ وجهةَ نظري، كنتُ سأواصِل إضافةَ المزيد والمزيد من الكلمات، ليصبح كلامي غير مفهوم أكثر فأكثر، بينما ستبدأ أنت في الاعتقاد بأنني على وشك أن أفقد عقلي، وستسأل نفسك لماذا لا يتوقَّف؟ هل يعتقد أنه يكتب ملحمة «الأوديسة»؟! وهكذا، سيكون الأمر مضيعةً كبيرةً للوقت والموارد.
لكن المثير للدهشة أن هذا بالضبط ما يفعله الإنزيم الذي ينسخ جيناتنا إلى الحمض النووي الريبي الرسول (آر إن إيه) RNA. يحتوي كل جين على إشارات واضحة للطرف الذي على وشك التكوُّن، وأولها تحديدًا هو كودون التوقُّف، وهو مجموعة من ثلاثة «حروف» تُنهِي عمليةَ تخليق البروتين، ثم الموضع المحدَّد بوضوحٍ حيث يُميَّز الحمض النووي الريبي الرسول المكتمِل بملحق يُعرَف باسم الذيل العديد الأدينين. ومع هذا، فإن إنزيم النَّسْخ هذا، واسمه بوليمريز الحمض النووي الريبي ?، يميل إلى تجاوُز إشارتَي التوقُّف كلتيهما ومواصلة إنتاج الحمض النووي الريبي العديم الفائدة، حتى بعد قطع الحمض النووي الرسول المطلوب وفصله كي يخضع لمزيدٍ من المعالجة. وحتى الآن، لم يجد الباحثون جزءًا محدَّدًا في شفرة الحمض النووي منقوص الأكسجين بإمكانه إيقاف هذا الإنزيم. في عام ????، ذكرت عدة فِرَق بحثية طرقًا تستطيع بها الخليةُ إيقافَ البوليمريز عن إهدار المكونات الأساسية للنيوكليوتيدات (بعد دراسة خلية كلٍّ من الإنسان والخميرة لهذا الغرض). وقد وجدوا أدلةً تشير إلى شيء كان حتى الآن محلَّ جدالٍ بصفته افتراضًا غير معقول، وتحديدًا آلية الطوربيد. وبناءً على هذا الافتراض، فإن الإنزيم الذي يهضم الحمض النووي الريبي — ويُعرَف باسم إنزيم النيوكليز الخارجي — يتعرَّف على الطرف المعلَّق من الحمض النووي الريبي الزائد ويبدأ في قطعه. (يجب أن تبدأ إنزيمات النيوكليز الخارجي من الخارج؛ أيْ من طرفٍ ذي نوعٍ خاصٍّ، في حين تستطيع إنزيمات النيوكليز الداخلي هضمَ الحمض النووي الريبي من المنتصف.) ومع تقدُّمِ إنزيم النيوكليز الخارجي على نحوٍ أسرع من البوليمريز، سيتمكَّن الأول من اللحاق بالثاني في نهاية المطاف، وسيجعله يتوقَّف بطريقةٍ تُعتبَر حتى الآن غير محدَّدة.
درس فريق ستيفن بوراتكاوسكي من جامعة هارفرد هذه الظاهرةَ في «خميرة الخبز»؛ حدَّدَ الباحثون إنزيم النيوكليز الخارجي «آر إيه تي ?» Rat1 وبروتينين مساعدين يربطان إنزيم «آر إيه تي ?» بالبوليمريز كي يستطيع أن يراقِبَ آلةَ النَّسْخ، ويتدخل بمجرد أن تبدأ في إنتاج حروفٍ غير مرغوبٍ فيها. يمكن للخميرة أن تعيش دون إنزيم «آر إيه تي ?»، ولكنها ستُنتِج قدرًا هائلًا من الحمض النووي الريبي غير الدالِّ (كلا، ليس له علاقة بالكحول الذي تنتجه الخميرة!) إذا تعطَّلَتْ وظيفة إنزيم «آر إيه تي ?» بسبب استبدال حمض أميني واحد فقط، فسيستمر تراكم الحمض النووي الريبي غير المرغوب فيه؛ مما يدعم بقوةٍ الافتراضَ بأن إنزيم «آر إيه تي ?» هو الإنزيم الهاضِم الذي يسعى وراء البوليمريز للَّحاق به وإيقافه. شكل ??-?: صورة تخطيطية لآلية الطوربيد، التي يُعتقَد أن الخلايا تستخدمها عندما يستمرُّ تخليقُ الحمض النووي الريبي إلى ما بعد نهاية التسلسل.
يبدو أن ثمة آلية مماثلة في الخلايا البشرية، إلا أن فريق نيك براودفوت وألكسندر أكوليتشيف في كلية السير ويليام دان لعلم الأمراض بجامعة أكسفورد قد اكتشف بعض التعقيدات الإضافية؛ ففي جين واحد على الأقل من الجينات التي درسوها، يكوِّن الحمضُ النووي الريبي «الزائد» الذي أنتَجَه البوليمريز ريبوزيمًا قادرًا على التضفير الذاتي، وهو مقطع من الحمض النووي الريبي يعمل كإنزيم ويحفِّز استئصالَ نفسه من جديلة الحمض النووي الريبي. (لكن سيعترض المتزمِّتون بحجة أن الإنزيم أو الريبوزيم الذي يحفِّز نفسَه يهدِم التعريفَ التقليدي للمُحفِّز؛ إذ إنه لا يخرج من التفاعل بلا تغيير. وقد قرَّرَ معظم علماء الكيمياء الحيوية تجاهُل هذا التعقيد الفلسفي.)
يوجد لدينا نحن البشر إنزيم نيوكليز مماثِل لإنزيم «آر إيه تي ?» في الخميرة، واسمه «إكس آر إن ?» Xrn2. درس ألكسندر أكوليتشيف وزملاؤه التعاونَ بين الريبوزيم وهذا النيوكليز، وباستخدام أبحاث الطفرات التفصيلية، ثبَّتوا أصغرَ مقطع حمض نووي ريبي مطلوب من أجل نشاط التضفير الذاتي الذي يقوم به الريبوزيم، واستطاعوا أن يبيِّنوا أن البوليمريز الهائج لا يمكن إيقافه إلا عندما يكون الريبوزيم عاملًا. من الواضح أن النيوكليز «إكس آر إن ?» — على عكس إنزيم «آر إيه تي ?» في الخميرة — لا يتعرَّف على الحمض النووي الريبي الذي ينتج عند استئصال الحمض النووي الرسول المناسب، وبالتالي تكون وظيفة الريبوزيم هي إنتاج الطرف الذي يتعرَّف عليه النيوكليز بالفعل ويبدأ في هضمه؛ كما أنه لا يتعرَّف أيضًا على أيِّ موضعِ قطعٍ قديم للريبوزيم. عندما استبدَلَ الباحثون هذا الريبوزيم بالريبوزيم التقليدي ذي رأس المطرقة، رفَضَ النيوكليز طرفَ الحمض النووي الريبي الناتج أيضًا. من غير المعروف حتى الآن عدد الجينات البشرية الأخرى التي تتطلَّب ريبوزيمًا لمساعدة النيوكليز «إكس آر إن ?». بما أن الريبوزيم الذي اكتشَفَه باحثو أكسفورد إلى جوار جين الجلوبين كان شاذًّا، فإنه لم يكن ليظهر خلال عمليات بحث التسلسلات التي تفحص وجود مثل هذه العناصر.
ووصولًا إلى هذه النقطة أكون قد انتهيتُ من كتابة كل ما أعرفه عن هذا الموضوع، ولكن بما أن حاسوبي ما زال مفتوحًا وأنا مستمتع بالكتابة، فقد أواصِل أيضًا التفكيرَ فيما يمكن أن يحدث إذا كان حاسوبي يمتلك نسخةً إلكترونية من نيوكليز «آر إيه تي ?». ها أنا ذا قد تخطَّيْتُ نهايةَ مقالتي، ومع هذا ما زلت أثرثر، وقد تظهر أيقونة باكمان صغيرة في نافذة تحرير النص لتبتلع سلسلة الكلمات هذه، وتمضغ الحروف بسرعة تفوق قدرتي على كتابة كلمات جديدة، لدرجة أنها ستدركني بعد بضع دقائق وسأصبح مجبَرًا على «التوقُّف».
(????)
أحدث التطورات

أحدثَتْ هذه الأبحاث الثلاثة ضجةً هائلة في عام ????، ولكني لم أسمع أنباءً مهمة بشأن هذا المجال منذ ذلك الحين. ومن المحتمَل أن يستغرق شرحُ تفاصيل هذه الآلية والتحقُّق من مدى انتشارها بعضَ الوقت.
قراءات إضافية

M. Kim et al., Nature, 2004, 432, S. 517–522.
S. West et al, Nature, 2004, 432, S. 522–525.
A. Ramadass et aI., Nature, 2004, 432, S. 526–530.

الفصل الرابع عشر
طابعات نافثة للخلايا


لا بد أن ننظر إلى الطابعات النافثة للحِبر بصفتها أحدَ أعظم اختراعات العصر، حتى ولو لأن الطابعة في حد ذاتها — عندما تكون جديدة تمامًا وبخرطوشة حبر، وتحتوي على آلة نسخ وماسِح مدمجين بها — يكون سعر شرائها أرخص من استبدال خرطوشتين بديلتين دون الطابعة. بالنظر إلى هذا الوضع غير المعقول، سيبدو من المنطقي أن نستبدل بالحبر شيئًا أرخص، مثل الخلايا الحيَّة. ولكن هل ستدفع فكرةُ الطباعة بالخلايا العلماءَ إلى الجنون بما ستقدِّمه من جميع أنواع رسائل الخطأ غير المفيدة؟
أثبتت الطابعات التجارية النافثة للحِبر فائدتها في تصنيع مصفوفات الحمض النووي وغيرها من التطبيقات المعملية، ولكن هل تستطيع خلايا كاملة أن تنجو خلال رحلتها عبر فوهة الطابعة؟ نجح فريق توماس بولاند من جامعة كليمسون بجنوب كاليفورنيا، في طبع أول خلايا بكتيرية، بل ثديية أيضًا.
على الرغم من أن الطباعة باستخدام أنواع شتى من الجزيئات بدلًا من الحِبر قد أصبحت بالفعل إجراءً روتينيًّا مُعترَفًا به في الكتب الأكاديمية، فإن الطباعة بواسطة الخلايا أمر مختلف تمامًا؛ إذ إنه بناءً على نوع الطابعة النافثة للحِبر التي يتم اختيارها، قد تتعرض الخلايا لاهتزازات أو الحرارة أو الضغط بمستويات مدمِّرة. استعان فريق بولاند في تجاربه بكلٍّ من الطابعة الكهربائية الإجهادية والطابعة الحرارية النافثتين للحِبر، ولكنه اكتشف أن الاهتزازات في الحالة الأولى كانت قوية للغاية. أما في حالة الطابعة الحرارية، فيمكن أن ترتفع درجات الحرارة حتى تصل إلى حوالي ??? درجة مئوية، إلا أن الباحثين كانوا يأملون أن يضمن التدفق السريع للمحلول ألَّا تستغرق الخلايا وقتًا طويلًا في منطقة الحرارة الخَطِرة.
بعد أن أثبت بولاند وفريقه سابقًا أن الخلايا البكتيرية تظل قابلةً للحياة بعد مرورها بفوهة الطابعة النافثة للحِبر، خاضوا التحدِّي الأكبر المتمثِّل في الخلايا الثديية، من خلال خلايا مبيض فأر هامستر صيني وخلاياه العصبية الحركية. في كلا النوعين من الخلايا، صمَّموا خصوصًا مادةً هلامية مائية — كبديلٍ لورق الطباعة — تتيح للخلايا الاستمرارَ في حياتها بعد انتهاء عملية الطباعة. وفي وجود الطابعة، و«الحبر» الحيوي، و«الورق» المناسب، بدأ الباحثون الطباعة؛ فاكتشفوا أن ما يزيد عن ??? من الخلايا نجَتْ من هذه العملية. وبعد رعاية الأنماط المطبوعة على مدار عدة أسابيع، لاحظوا أن كلا النوعين من الخلايا يسلك السلوكَ المعتاد المتوقَّع منه، فعلى سبيل المثال عقدت الخلايا العصبية روابطَ جديدة بعضها مع بعض.
حتى الآن، لم يطبع الباحثون الخلايا إلا بنمطٍ حلقي الشكل، وسيكون التحدِّي القادم بالنسبة إليهم هو تطبيق هذه الطريقة على أنماط مهمة بيولوجيًّا، بما في ذلك بِنى الأنسجة وتنسيقاتها، التي تتضمن أكثر من نوع خلية واحد. وباستخدام خرطوشة نافثة للحِبر رباعية اللون، يمكن تحويل رسمٍ تخطيطي مصنَّف بحسب اللون على شاشة الكمبيوتر إلى نسيجٍ حيٍّ على ركيزة المادة الهلامية مباشَرةً.
(????)
أحدث التطورات

تُعتبَر هندسة الأنسجة تحدِّيًا مهمًّا في مجال الأبحاث الطبية البيولوجية في الوقت الحاضر. وبحسب فهمي للأمر، فإن إنتاجَ الركائز التي يمكن طباعةُ أنماط الخلايا شبه الحيَّة عليها هو التحدِّي الأساسي؛ لذا احتفِظ بطابعتك القديمة النافثة للحِبر، وانتظر حتى يصبح الورقُ متاحًا.
قراءات إضافية

E. A. Roth et al., Biomaterials, 2004, 25, 3707.
T. Xu et al., Biomaterials, 2005, 26, 93.

الفصل الخامس عشر
وراثة مُجعَّدة


توجد موضوعات تافهة مثل تصفيفات الشعر لا تشغل عقلي الواعي مطلقًا، ولكني أستثني منها هذا المقال، ويُعزَى هذا جزئيًّا إلى أنني أحمل أنا نفسي جين التجعُّد. وبالطبع، فإن تصفيفةَ شعر أينشتاين المتعدِّدة الاتجاهات لا تزال ضرورة بالنسبة إلى أيِّ عالِمٍ طموح.
هل يبدو شعرك مُجعَّدًا اليوم؟ أَلَا يرضيك شكله اليوم؟ مع أن الجهات الإعلانية تريدنا أن نعتقد أن مظهرَ شعرِنا هو مسألة يحكمها في المقام الأول شراءُ المنتجات المناسبة للعناية به، فقد يكون أيضًا مسألةً يتحكَّم فيها امتلاكُ الجينات المناسبة. كما جَرَتِ العادة، خضعت هذه المسائل المتعلقة بالشعر لدراساتٍ في ذبابة الفاكهة، دون اهتمام كافٍ بالحيوانات الأكبر مثل البشر، إلا أن فريقًا بقيادة جيريمي نيثانز من جامعة جونز هوبكينز قد حقَّقَ نقلةً حاسمة بتحويل موضوع الدراسة في هذه الأبحاث من الذباب إلى البشر، عن طريق إثبات أن ثمة جينًا واحدًا من الفصيلة المُجعَّدة يتحكَّم في اتجاه الشعرة، ليس فقط في الذباب ولكن أيضًا في الفئران.
الفئران التي تفتقر إلى هذا الجين تتكوَّن لديها ثنيات من الشعر في أماكن غير معتادة، مع أنها بدَتْ سليمةً في بقية الأماكن وصولًا إلى بصيلات الشعر. من الواضح أن السبب هو الخلايا الظهارية (أي: خلايا الجلد) التي تجعل الشعر يتخذ الاتجاه الخاطئ. وما دمنا فسَّرْنا الأمر في حالة الفئران المُجعَّدة، فلن يتعدَّى الأمر شهورًا قلائل حتى يجاب عن الأسئلة المدهشة التي تدور حول الأصول الجينية للشعر الأشعث في البشر. سنحتاج أيضًا أن نعرف إن كانت ثمة علاقة بين هذه الأصول الجينية للشعر الأشعث وبين المهارة الموسيقية والفنية. ولتترقب الجيل الجديد من منظفات الشعر «للشعر المُجعَّد أو المُعقَّد جينيًّا.»
(????)
أحدث التطورات

كما قلتُ، ليست لديَّ أدنى فكرة عن أحدث التطورات.
قراءات إضافية

N. Guo et al., Proc. Natl Acad. Sci. USA, 2004, 101, 9277.

الفصل السادس عشر
كيف تأكل دون مَعِدَة؟


أدهشَتِ الديدان الأنبوبية الخبراءَ والقرَّاء غير المتخصِّصين على حدٍّ سواء، باعتبار أنها تعويذة الحياة في ظلِّ الظروف القاسية. فنظرًا لأنه من الصعب للغاية استيلادها وهي في الأَسْر، كانت الأبحاث التي تتناول أنماطَ حياتها الغريبة تشهد تقدُّمًا بطيئًا للغاية خلال العقود التي تلَتِ اكتشافَها، وإلى الآن لا تزال تظهر اكتشافات مدهشة بشأنها.
تبدو الديدان الأنبوبية «ريفيا باكبتيلَّا» مثل فُرْشَات دهان عملاقة مغطَّاة باللون الأحمر، ومن ثمَّ فهي أروع الكائنات الموجودة حول الينابيع الساخنة لأعماق البحار والفوهات الحرارية المائية. ولأنها تفتقر إلى جهازٍ هضميٍّ، فإنها تعتمد على البكتيريا المخلَّقة كيميائيًّا التي تعيش داخل «كيس التغذية» الخاص بها لتزودها بالمواد المُغذية العضوية، وفي المقابل تنقل الديدان كلًّا من الأكسجين والكبريتيد من خياشيمها الحمراء إلى كيس التغذية. والمثير للدهشة أنها تنقل كلا الجزيئين على نفس الناقل، وهو عبارة عن صورة خارج الخلية من الهيموجلوبين، وتنجح في منعهما من التفاعل أحدهما مع الآخَر. ولقد تحدَّتِ الآنَ أولُ بنيةٍ بلورية على الإطلاق لجزيء الهيموجلوبين وجهةَ النظر التقليدية المتعلِّقة بآلية حدوث هذا الانتقال.
شكل ??-?: مقطع عرضي للدودة الأنبوبية «ريفيا باكبتيلَّا» يبيِّن كيسَ التغذية الذي تعيش فيه البكتيريا التكافلية.
حلَّ جيسون فلوريس وفريقه من جامعة ولاية بنسلفانيا البنية البلورية لهيموجلوبين «سي ?» C1، وهو أحد نواقل الأكسجين الثلاثة المختلفة خارج الخلية في الديدان الأنبوبية. يحتوي هيموجلوبين «سي ?» على ?? وحدة فرعية من البروتين، ويتميَّز كلٌّ منها بطيَّة الميوجلوبين التقليدية، وهي الترتيب المميز لثمانية حلزونات ألفا كشَفَ عنها جون كيندرو في أول بنية بروتينية تمَّ حلُّها على الإطلاق. يتم ترتيب الوحدات الفرعية في حلقتين لثلاثة رباعيات، كما في دودة الأرض الشائعة المسمَّاة «شحمة الأرض». لكن على عكس أي جلوبين معروف آخَر، كشفَتِ البنية البلورية لهيموجلوبين الديدان الأنبوبية عن وجود ?? أيونًا فلزيًّا غير مخضَّب، واحد في كل رباعي، بالإضافة إلى ستة يشترك فيها رباعيَّان، وأظهر مطياف الكتلة أن هذه الأيونات هي أيونات الزنك Zn+2. دفع هذا الاكتشاف بفلوريس وزملاءه إلى الشك في أن أيونات الزنك قد تكون مشتركة في الارتباط بالكبريتيد، خصوصًا أن بقايا السيستئين الحرة — التي كان يُعتقَد في السابق أنها تُربط بالكبريتيدات — مدفونةٌ بعمقٍ في الأجزاء الكارهة للماء في البنية. كشفَتِ الدراساتُ التفصيلية حول عملية الارتباط أن أيونات الزنك تفسِّر بالفعل معظمَ الارتباط الكبريتيدي للبروتين، إنْ لم يكن كله. ويذكر فلوريس وآخَرون أنهم فشلوا في التوصُّل مرةً أخرى إلى نفس النتائج التي سبَقَ أن أوضحَتِ اشتراكَ بقايا السيستئين الحرة في ارتباط الكبريتيد. تبدو إعادةُ ترتيب روابط ثنائي الكبريتيد غيرَ محتمَلة؛ نظرًا لعدم ظهور معلوماتٍ عن تغييرات تكوينية رئيسية تتعلَّق بعملية الارتباط. وهكذا لم يُزَحِ الستارُ عن الحقيقة بأكملها بعدُ.
(????)
أحدث التطورات

في عام ????، نجح توماس شفيدر وفريقه من جامعة جرايفسفالد بألمانيا، بالتعاون مع زملاء لهم في كاليفورنيا، في الحصول على فكرةٍ حول ما يحدث في أعماق الدودة الأنبوبية، وتحديدًا داخلَ كيس التغذية، حيث تُنتِج بكتيريا غريبة المغذيات التي تحافظ على بقاء الدودة وحياتها.
حتى الآن، لم ينجح أحدٌ في استيلادِ البكتيريا الموجودة داخل كيس التغذية الخاص بالدودة الأنبوبية في بيئة استنباتٍ نقية، وربما لن ينجح أحد في ذلك على الإطلاق؛ لذا، يعتمد الباحثون على المادة التي يمكنهم الحصولُ عليها مباشَرةً من كيس التغذية. ولحسن الحظ، اتضح أن هذه المادة نقيةٌ للغاية، حيث يبدو أن جميع الجزيئات الحيوية التي تحتوي عليها مأخوذةٌ من نوع واحد؛ أَلَا وهو البكتيريا التي تغذِّي الدودة.
ولكي يفهم الباحثون آليةَ عمل الأيض في هذه البكتيريا وتكافُلها مع الدودة الأنبوبية، حلَّلوا مجموعةَ البروتينات الكاملة التي تُنتِجها البكتيريا، المعروفة باسم البروتيوم. وبالاستعانة بتقنيةٍ تقليديةٍ للتحليل الكيميائي الحيوي، وهي الترحيل الكهربائي للهلام الثنائي الأبعاد، قاموا بفرد البروتيوم على نمطٍ ثنائيِّ الأبعاد مميز للمواضع البروتينية. وبهذه الطريقة، تُستخدَم معاييرُ فصلٍ مختلفة في كل بُعْد (مثل: الكتلة والشحنة) بحيث ينتقل كلُّ بروتين إلى موضع محدَّد في النظام الإحداثي الديكارتي، كي يمكن رصدُه بواسطة المزيد من التقنيات التحليلية، بما في ذلك تقنية التسلسل النووي.
بهذه الطريقة، استطاع الباحثون بالفعل تحديدَ أكثر من ??? بروتينًا في البكتيريا المستوطنة في كيس التغذية، ووجدوا بين هذه البروتينات العديدَ مما توقَّعوا وجوده، ولكنَّ البعضَ الآخَر كان مفاجئًا.
أحد الافتراضات المعقولة إلى حدٍّ ما حول متعايشي أعماق البحر، بالنظر إلى أنها تحلُّ محلَّ النباتات بتأديتها دورَ المنتِج الأساسي؛ أنها — مثل النباتات — تستخدِم دورةَ كالفِن لإنتاج الجزيئات الحيوية. سُمِّيَ هذا المسار الحلقي نسبةً إلى ميلفِن كالفِن (????–????) الذي استخدَمَ الواسمات المشِعَّة لتحديد مسارات عمليات الأيض للتمثيل الضوئي، وهذا المسار يمرِّر الطاقةَ والكربونَ الناتجَيْن من التفاعل الضوئي من أجل إنتاج الجزيئات الحيوية. قد يتوقَّع المرء أن تستخدِم البكتيريا المُخلَّقة كيميائيًّا نفسَ الدورة، على الرغم من وجود فارق وحيد يتمثَّل في أنها ستكتسِب الطاقةَ من التفاعلات الكيميائية (مثل أكسدة مركبات الكبريت المختزلة) بدلًا من التفاعلات الضوئية الكيميائية.
عثَرَ الباحثون بالفعل على جميع الإنزيمات اللازمة لدورة كالفِن. ومع هذا، عُثِر على إنزيم رئيسي واحد فقط بكميات ضئيلة. يحفِّز إنزيمُ روبيسكو (كربوكسيلاز ثنائي فوسفات الرايبولوز-?، ?) الخطوةَ التي يدخل فيها ثاني أكسيد الكربون الدورةَ، عن طريق الارتباط بسكر ثنائي فوسفات الرايبولوز. وفي الأجزاء الخضراء من النباتات، يمكن أن يشكِّل إنزيم روبيسكو أكثرَ من نصف المحتوى البروتيني، وبالتالي فمن المحتمَل أن يكون أكثرَ البروتينات وفرةً على سطح الأرض. ولكن، على العكس من ذلك، قدَّر شفيدر وزملاؤه أن إنزيم روبيسكو يشكِّل ?? فقط من البروتين الذي وجدوه في أكياس التغذية؛ ولهذا السبب يعتقدون أن الخلايا التي يندر فيها وجود روبيسكو يبدو أنها لا تستخدم دورة كالفِن مثلما تفعل النباتات.
ما الطرق الأخرى المتاحة أمام البكتيريا لتكوين الجزيئات الحيوية؟ بتحليل الباحثين للهلام الثنائي الأبعاد الخاص بها، اكتشفوا وسائلَ لدورةٍ ثانية معروفة جدًّا لعمليات الأيض، وهي دورة كريبس (نسبةً إلى هانز كريبس، ????–????، الذي استطاع أن يصف في بحثِه الفائزِ بجائزة نوبل هذه الدورةَ، وهو البحث الذي رفضَتْه مجلةُ «نيتشر»). في حالتنا نحن الكائنات الحية، توجد دورةُ كريبس في الميتوكندريا، وتعمل على هضم الجزيئات الحيوية واستغلال طاقتها؛ وبالتالي تصبح عديمةَ الفائدة بالنسبة إلى البكتيريا المخلَّقة كيميائيًّا.
مع هذا، فمن الممكن إحداث دورة كريبس بالعكس، واستخدامها لتكوين الجزيئات الحيوية بدلًا من تدميرها. بل اعتقد العلماء أن دورةَ كريبس المعكوسة ربما تكون أقلَّ استهلاكًا للطاقة مقارَنةً بدورة كالفِن، بحسب التركيزات الصحيحة من الإنزيمات والركائز. علاوة على ذلك، يفسِّر هذا الأمر النسبةَ غير المعتادة لنظائر الكربون الموجودة في البكتيريا المخلَّقة كيميائيًّا، التي تختلف عن النسبة المعروفة في النباتات.
لكن، لماذا تملك البكتيريا دورتين معقَّدتين لعمليات الأيض في حين أنه تكفيها دورةٌ واحدة؟ يشكُّ شفيدر وزملاؤه في أن هذه البكتيريا تستطيع الانتقالَ بين كلا النمطين لعملية الأيض على حسب البيئة المحيطة. ويبدو أن الأبحاثَ التجريبية الأولى تشير إلى أنه عندما يوجد الكثيرُ من الوقود الكبريتي في البيئة المحيطة، فإن البكتيريا تفضِّل دورةَ كالفِن الأقل استهلاكًا للطاقة، ولا تلجأ إلى دورة كريبس إلا عند الحاجة.
قراءات إضافية

J. F. Flores et al., Proc. Natl. Acad. Sci. USA, 2005, 102, 2713.
S. Markert et aI., Science, 2007, 315, 248.

الفصل السابع عشر
الفلك يساعد في رصد أسماك القرش الحيتانية


(نُشِر هذا المقال لأول مرة بقلم مايكل جروس في مجلة «كرنت بيولوجي» عام ????، المجلد ??، العدد ?، آر?-آر? ستلر إنسايتس.)
في السنوات الأخيرة كتبتُ بعضَ المقالات عن المشروعات البحثية التي يدعمها معهدُ إيرث ووتش الخيري، الذي ينظِّم مشاركةَ المتطوعين الذي يدفعون اشتراكات في مشروعات حول العالم. مع أن جميع مشروعاتهم ممتعة بطريقة أو بأخرى، فإن أكثرها إثارةً هو المشروع الفلكي المختص بالأحياء المائية، وتحديدًا أسماك القرش الحيتانية، الذي سأعرضه هنا.
ربما تكون الأبحاثُ المتعددة الاختصاصات شائعةً للغاية، ولكن لا يزال من الصعب العثورُ على وسائل فلكية لاستخدامها في أبحاث حماية البيئة. ومع هذا، تعاوَنَ كلٌّ من الباحث زافِن أرزومانيان من وكالة ناسا الفضائية، وعالِم الأحياء البحرية براد نورمان من جامعة مردوخ الأسترالية لتنفيذ ذلك.
فقد عدَّلَا معًا ما يُطلَق عليه اسم خوارزمية جروث، التي يستعين بها علماءُ الفلك لمقارَنةِ الأنماط المثلثة في صور سماء الليل، من أجل تهيئتها لمهمة التعرُّف على الحيوانات المرقطة مثل «أسماك القرش الحيتانية»، التي تُعتبَر أكبرَ سلالات الأسماك الموجودة. وعلى غرار ما يراه المرءُ في سماء الليل، يتباهى القرش الحوتي بانتشارٍ رائعٍ للبُقَع المضيئة على خلفية سوداء (انظر الشكل ??-?). شكل ??-?: أسماك القرش الحيتانية حيوانات مسالِمة. شكلها المميَّز ذو البُقَع المضيئة على خلفية سوداء يتيح للباحثين التعرُّفَ على حيوانات بعينها.
إن التعرُّفَ على حيوانات بعينها مهمة ضرورية في أبحاث حماية البيئة، ولكنها صعبة. ولكن عندما يستطيع الباحثون التعرُّفَ على أسماك القرش من أنماط البقع المنتشرة على أجسامها، فلن توجد حاجة إلى اتخاذِ المزيد من الإجراءات التشريحية والمستهلكة للوقت. وقد أوضَحَ الباحثان أن الطريقة «الفلكية» تتيح لنا التعرُّف على الحيوانات بدقة عالية، وبمساعدة خبير البرمجيات جيسون هولمبِرج، أدخلا بالفعل الطريقة الجديدة في مكتبةٍ على الإنترنت للتعرُّف البصري (http://photoid.whaleshark.org)، تعمل على أرشفة الصور الرقمية لأسماك القرش الحيتانية. يفتخر براد نورمان بأداء وسيلته البحثية الجديدة، ويعبِّر عن حماسه تجاهها قائلًا: «لقد طابَقَ البرنامج بين صورٍ لم ألحظها في البداية، ونجح منذ ذلك الحين في مطابقة ??? صورة تمَّ التحقُّقُ منها يدويًّا فيما بعدُ. ولم نَعُدْ بحاجةٍ الآن إلى بعثرة جميع الصور على الأرض.»
بمساعدة معهد إيرث ووتش الخيري المتخصِّص في الأبحاث البيئية، صار بمقدور نورمان الآن تطبيق هذه التقنية على نطاق واسع، ويستطيع أيُّ شخص الانضمامَ إليه فعليًّا. لقد بادَرَ معهد إيرث ووتش بتقديم طرق جديدة تضمُّ متطوعين يسدِّدون رسومًا في المشروعات البحثية التي لم تكن لتنجح دون ذلك؛ بسبب نقص الأيدي العاملة. أُنشِئ معهد إيرث ووتش عام ???? في مدينة بوسطن بولاية ماساتشوستس، وهو يستعين الآن ? ???? متطوع سنويًّا يعملون على ??? مشروعًا مختلفًا حول العالم.
يهدف مشروع براد نورمان «أسماك القرش الحيتانية في شعاب نينجالو» برعاية معهد إيرث ووتش؛ إلى التعرُّف على تأثير السياحة وظروف المحيط على حياة أسماك القرش الحيتانية وهجرتها، تلك الأسماك التي تتغذَّى عن طريق ترشيح ماء البحر، ولا تُعتبَر مؤذيةً إطلاقًا. ما بين شهرَيْ أبريل ويونيو من عام ????، عملَتْ ثماني فِرَق مكوَّنة من ستة إلى ثمانية متطوِّعين، تعمل كلٌّ منها أسبوعًا واحدًا، على ملاحظة هذه الحيوانات وتصويرها في حديقة نينجالو البحرية، الواقعة بالقرب من ساحل أستراليا الغربية، حيث أصبحت أسماك القرش هذه وغيرها من حيوانات المحيطات أساسَ السياحة البيئية المزدهرة.
صُمِّمَ البحثُ خصوصًا لتحديدِ معدل عودة هذه الحيوانات إلى المنطقة وإلى أجزاء معينة من الشِّعاب، ومعرفة أي مواقع مفضَّلة بالنسبة إلى أفراد تلك الحيوانات، ومعدلات نموها، وسلوكها، وذلك تحت ضغط مجال السياحة المتنامي (على الرغم من أن هذا الأمر لقي استحسانًا على نطاق واسع بصفته مثالًا للسياحة البيئية «السليمة»). وحتى الآن، فإن ما يعوق مجهودات حماية هذه السلالة المهدَّدة هو غياب المعلومات الضرورية للغاية، بما في ذلك أعداد هذه السلالة على مستوى العالم، وتاريخ الحياة النمطي لأفرادها. ولكن عن طريق تزويد مشروع الرصد بالمتطوعين خلال موسم أسماك القرش وعلى مدار عدة سنوات، يأمل نورمان في زيادة المعرفة بهذه المجالات؛ ومن ثَمَّ المساعدة في جهود إنقاذ هذه السلالة.
مع أن المنهجية صُمِّمت خصوصًا من أجل مشروع أسماك القرش الحيتانية، فإن الباحثين يؤكِّدون أنها صالحة للتطبيق إلى حدٍّ كبير على سلالات أخرى أيضًا، ما دامت سلالاتٍ مرقطة. ويوضِّح روجر ميتشِل، كبير العلماء بمعهد إيرث ووتش (أوروبا) أن «الأُسُودَ، على سبيل المثال، تتمتع ببقع سوداء صغيرة في مواضع التقاء شواربها بأنوفها، وهذه السمة المميزة قد تساعد في تقفِّي أثرِها في المستقبل القريب.»
أتساءل إن كانت أسماك القرش الحيتانية تنظر إلى سماء الليل، وبمَ تفسرها؟
(????)
أحدث التطورات

لقد أصبح برنامج التعرُّف على الأنماط شائعًا للغاية في الأبحاث المعنِيَّة بحماية البيئة خلال السنوات الأخيرة. ففي عام ????، أعلن المركز القومي البريطاني لإحلال الحيوانات وتنقيحها واختزالها في الأبحاث عن تمويلِ العديد من المشروعات، بما في ذلك مشروعٌ يستخدِم منهجًا مماثِلًا للتعرُّف على ضفادع معيَّنة في المعمل. والمعضلة الجوهرية التي ينوي مات جيل من جامعة بورتسموث تناوُلَها من خلال بحثه، هي أن الضفادع يجب أن توجد في جماعات كبيرة كي تعيش حياة طبيعية، ولكن يجب في الوقت نفسه تمييزُ كلٍّ منها على حدة. ومع أن جميع طرق التعرُّف الحالية تشريحيةٌ أو ضارةٌ إلى حدٍّ ما، فإن جيل يأمل في التوصُّل إلى طريقةٍ «تقيس النمطَ الموجود على ظهور الحيوانات وأقدامها باستخدام التصوير الرقمي، وبالتالي لا تضر الضفدع. وإذا نجحَتْ هذه التقنيةُ، فسيتم تسويقها تجاريًّا.»
قراءات إضافية

Z. Arzoumanian et aI., J. Appl. Ecol., 2005, 42, 999.
www.earthwatch.org.

الفصل الثامن عشر
تحدَّث إلى بروتيناتك


في عام ????، نشرتُ بحثًا نظريًّا بعنوان «تحليل لغوي لطيِّ البروتين». عندما كتبته، لم أستطع أن أعثرَ على أيِّ بحثٍ آخَر يجمع بين الكلمتين الرئيسيتين: لغوي وبروتين، ولكني اكتشفتُ لاحقًا أن شخصًا آخَر قد نشَرَ بحثًا عن الموضوع نفسه قبل ظهور بحثي بشهر تقريبًا. بعد ذلك، ظلَّ هذا المجال متداخِل الاختصاصات على نحوٍ مدهِشٍ غير مُستكشَف لعدة سنوات، إلى أن عاد باحثون آخَرون إليه مؤخرًا؛ مما منحني فرصةَ التفاخُر والاستشهاد ببحثي.
حروفٌ، حروف في كل مكان. فمع استمرار تدفُّق التسلسلات الجينومية، واشتقاق العلماء لآلاف التسلسلات البروتينية الجديدة منها، صارَتِ الحاجةُ إلى طرق جديدة لفهم كل هذا التكدُّس المعلوماتي أكثرَ إلحاحًا من ذي قبلُ. يقترح الباحث الإيطالي المتخصِّص في دراسة البروتينات ماريو جيمونا أن المناهجَ المستعارة من علم اللغة قد تُحدِث ثورةً في تحليل البيانات المتعلِّقة بالبروتيوم وشرحها، ويُقصَد به مجموع البروتينات المُشفَّرة بجينوم سلالة معينة.
مع أن التحليل اللغوي للجينات يتم إجراؤه منذ عقود، فإنه لم تظهر اعتباراتٌ مماثِلةٌ بخصوص البروتينات إلا في عام ????. يبدأ التشابه بسيطًا؛ إذ إن كلًّا من التسلسلات البروتينية والجُمَل الإنجليزية تتكوَّن من «حروف» تمثِّل العشرين حمضًا أمينيًّا في الحالة الأولى، وعدة أصوات في الحالة الثانية. ويكمن التحدِّي في تحديد كيفية الانتقال إلى مستويات التعقيد التالية، والتمكُّن من قراءة «كلمات» و«عبارات» و«جمل» اللغة البروتينية. يقول خبيرُ طيِّ البروتينات كيفين بلاكسو من جامعة كاليفورنيا في سانتا باربرا: «ترتبط هذه المشكلة ارتباطًا وثيقًا ? «مشكلة التكهُّن» المتعلِّقة بطيِّ البروتينات، وهي مشكلة لم يُطرَح لها حلٌّ حتى الآن. ومن الناحية النظرية، فإننا نريد أن نكون قادرين على قراءة أية سلسلة من الأحماض الأمينية وفهم «معناها» بنفس سهولة قراءتنا للجملة الإنجليزية.»
لكي يتحقَّق هذا، يجب أن يفهم المرء «قواعدَ لغةِ» البنية البروتينية وعملية الطيِّ. ومع أنه لم تُقترَح حتى الآن قواعدُ مترابطة لِلُّغة البروتينية تغطي جميع المستويات، بدءًا من تسلسل الحمض الأميني وصولًا إلى التفاعلات الوظيفية، فإن جيمونا يقترح أن وحدات البروتين (أي: النطاقات المستقلة الطي التي يمكن أن تعمل بمنزلة عناصر تصميمية على نطاقٍ متوسط في البروتينات الأكبر، وعادةً ما يتمُّ نسْخُها وإعادة استخدامها بفعل التطوُّر) تلعب دورًا محوريًّا في فهم قواعد لغة البروتين. وهو يقترح قائلًا: «إن النطاقات والوحدات تمثِّل الوحدات النحوية والدلالية في البروتين.» وهو متفائِلٌ بخصوص تطبيق الأساليب اللغوية في علم البروتين، فيقول: «عندما ينقشع الضبابُ المحيط بهذه المسألة، ربما نصبح جميعًا علماءَ لغةٍ جزيئيةٍ!»
(????)
أحدث التطورات

ما زلتُ آمل أن يحقِّق استخدامُ الوسائل اللغوية في بيولوجيا البنية البروتينية إنجازًا كبيرًا، ولو لكي يتمكَّن مزيد من الناس من الاستشهاد بذلك البحث المبدئي الذي كتبتُه …
قراءات إضافية

M. Gross, FEBS Lett. 1996, 390, 249.
M. Gimona, Nature Rev. Mol. Cell Biol. 2006, 7, 68.

الفصل التاسع عشر
مُستَخْفون قدماء في عيوننا


على مدى بضع سنوات، كنتُ أفتخر بلقب الكاتِب العلمي خلال فترة قيامي بالأبحاث في قسم علم البلوريات بكلية بيركبيك في جامعة لندن، وأحد المجالات البحثية التي كان يستهدفها هذا القسم هي دراسة بروتينات عدسة العين، وبنيتها وتطوُّرها. يتناول المقال التالي بروتينًا بنائيًّا لعدسات العين لدى الفقاريات، وُصِف بأنه الأكثر شبهًا بسينثيتاز الجلوتامين في البكتيريا؛ مما يوحي بأن «الجمع بين وظيفتين» قد أنقَذَ البروتين من النسيان عندما استولَتْ عائلة مختلفة من الإنزيمات على دوره الأصلي.
لطالما أثارَتْ بروتينات عدسات العين دهشةَ العلماء وفاجأتهم بسبب استقرارها المستمر مدى الحياة وتاريخها التطوُّري غير العادي، والآن اكتشَفَ الباحثون إنزيمًا بكتيريًّا يفقد وظيفته الأصلية في الكائنات الحية الراقية بسبب عائلة مختلفة من البروتينات، ويمارس دورًا بنائيًّا في عدسات العين لدى الفقاريات.
أجرى جريم ويستو وزملاؤه في المعهد القومي للعيون في بيت حِسْدَا، في ماريلاند بالولايات المتحدة، بالتعاون مع باحثين من كلية بيركبيك في جامعة لندن بالمملكة المتحدة، أبحاثًا وراثية وبنائية على بروتين لينجسين (بروتين العدسات الشبيه بسينثيتاز الجلوتامين) في الفئران وغيرها من سلالات الفقاريات الأخرى.
كشفَتْ مقارَنةُ التسلسل النووي والتحليل البنائي بواسطة الفحص الميكروسكوبي الإلكتروني البَرَدي عن تاريخ تطوُّريٍّ مذهل. فعلى عكس سينثيتاز الجلوتامين في الفقاريات، يحوي اللينجسين مركبًا متماثِلًا يتكوَّن من ?? وحدة فرعية، مثلما تفعل النسخةُ البكتيرية العتيقة من الإنزيم. وبالمثل، كشفَتْ إعادةُ بناء شجر العائلة بمساعدة دراسات الطفرات عن أن بروتين العدسات في الفقاريات هو أحد أعضاء العائلة البكتيرية لبروتينات سينثيتاز الجلوتامين المعروفة باسم «جي إس ?» GS1. كان هذا هو أول عضو غير بكتيري في العائلة يتمُّ اكتشافه، إلا أن بحثًا لاحقًا في جينوم قنفذ البحر كشَفَ عن عدة جينات مرشَّحة لإنتاج بروتينات مماثلة في هذا الكائن الحي. وحتى الآن، لا يُعرَف الموضع الذي يعبِّر فيه قنفذ البحر — الذي لا يملك عيونًا — عن البروتينات المماثلة، ولا يُعرَف فيمَ تُستخدَم.
اختبر ويستو وزملاؤه اللينجسين المأخوذَ من عدسات عين الفأر بحثًا عن أيِّ نشاط إنزيمي مرتبط بوظيفة سينثيتاز الجلوتامين الموروث، ولكنهم لم يجدوا شيئًا. وتماشيًا مع هذا الاكتشاف، عُثِر على إحدى بقايا الحمض الأميني التي تُعتبَر ضرورية لسينثيتاز الجلوتامين بعد أن تعرَّضت للطفرات في بروتينات اللينجسين بالفقاريات. ويشكُّ الباحثون في أنها ربما تؤدِّي دورًا بنائيًّا في عدسات العين.
توجد أمثلة سابقة لبروتينات إنزيمية تؤدِّي وظائفَ مختلفة في عدسات العين، حسبما يشرح ويستو قائلًا: «نحن معتادون على فكرة أن الإنزيمات — مثل إنزيم نازعة هيدروجين اللاكتات — تؤدِّي أدوارًا جديدة في عدسات العين لدى الفقاريات.»
إلا أنه في هذه الحالة ثمة منعطف جديد في قصة التطور؛ يقول ويستو: «المفاجأة الكبرى في هذه القصة هي إدراك أن اللينجسين قديم للغاية، وينحدر في الواقع من عائلة إنزيمية لم تكن موجودة إلا في بدائيات النواة.» ويضيف قائلًا: «يبدو أن إنزيمات هذه العائلة كان يُعبَّر عنها في الواقع في أسلاف فقارية عتيقة للغاية، ولكنها فُقِدت خلال التطوُّر البيولوجي. وقد بقي عضو واحد في جينوم الفقاريات؛ لأنه اكتسَبَ دورًا مختلفًا ومتخصِّصًا في العدسات، مما جعله يفقد دورَه التحفيزي الموروث في العملية.»
(????)
قراءات إضافية

K. Wyatt et al.; Structure, 2006, 14, doi: 10.1016.j.str.2006.10.008.

الفصل العشرون
كشف أسرار إنسان النياندرتال


في عام ????، كان الجينوم البشري قد اكتمَلَ على نحوٍ تقريبي، بعد مجهود دولي كبير استغرق قرابة عشر سنوات. وبعد خمس سنوات، ركَّزَ الباحثون انتباههم على جينوم السلالة البشرية المنقرضة؛ النياندرتال. وأظنني لا أحتاج إلى تذكيركم بأنه كان ثمة أكثر من ستة مليارات نموذج من «الإنسان العاقل» منتشرة في جميع أنحاء كوكبنا، تستطيع أن تمدنا بالكثير من الحمض النووي البشري لو احتجنا إلى كلِّ هذا القدر، بينما انطلق مشروع النياندرتال بعيِّنَة حمض نووي متآكلة ومفتَّتة ومتعفِّنة بصفة عامة، وتزن كلها ?? ملِّيجرامًا. لو لم يكن هذا جنونًا، فلا أعلم بأي شيء آخَر أصفه. ومع هذا، فبمجرد قراءتي للأبحاث، أقنعني الباحثون أن هذا المشروعَ مشروعٌ طموح يستحق التنفيذ. علاوة على ذلك، فإن النياندرتاليين لَطالما كانوا نقطةَ ضعفي، حتى إنني قمتُ ببعض الأبحاث عنهم بنفسي.
الكشف عن عظام قديمة

غالبًا ما تتعرَّض أبحاث الجينوم التي تُجرَى عن سلالات منقرضة للسخرية، فتُترَك فقط لمجال الخيال العلمي في فيلم «حديقة الديناصورات». لا توجد سوى بضعٍ من عظام الحفريات محفوظةٍ جيدًا لتمنح الباحثين أملًا في أنهم قد يستعيدون الحمضَ النووي لأصحابها الأصليين. وحتى لو أمكن العثور على الحمض النووي، فهو مفتَّتٌ إلى حدٍّ كبير ومخلوطٌ بالمادة الوراثية لسلالات أخرى، مثل بكتيريا التربة.
لم تَزُلْ هذه المشكلاتُ الجوهرية، ولكن ما تغيَّرَ خلال السنوات القليلة الماضية هو أن طُرُقَ البحث الجينومي الآن أصبحَتْ متقدِّمةً للغاية، لدرجة أنها تستطيع التعامُل مع هذا الموقف. في التسلسل الجينومي الحديث، بحسب أسلوب التسلسل النووي القسري الذي ابتكره كريج فينتر، سيتمُّ تفكيكُ الحمض النووي على أية حال، ويقع الآن حجمُ المقطَعِ النمطي للحمض النووي القديم ضمنَ النطاق الذي تستطيع أجهزةُ التسلسل استخدامه على نحوٍ روتينيٍّ. أما بالنسبة إلى مسألة التلوُّث بالحمض النووي للسلالات الأخرى، فإن توافُرَ مئات الجينومات البكتيرية المسجَّلَة في قواعد البيانات — إلى جانب الجينوم البشري وعشرات الجينومات الأخرى للكائنات المتعدِّدة الخلايا — يتيح للباحثين فحْصَ كلِّ مقطع يعمدون إلى ترتيب تسلسُلِه النووي، والتحقُّقَ من نوع الكائن الحي الذي جاء منه.
شكل ??-?: انقرَضَ النياندرتاليون، أو «إنسان النياندرتال»، منذ ?? ألف عام. والمعلومات الجينومية المأخوذة منهم ليست مفيدةً في المسائل التاريخية فحسب، ولكن أيضًا في مساعدة العلماء على فهم التنوُّعِ الوراثي للبشر الموجودين حاليًّا.
اعتمَدَ سفانت بايبُو وزملاؤه من معهد ماكس بلانك للأنثروبولوجيا التطورية في مدينة لايبزيج الألمانية على هذه الاعتبارات خلال عملهم، وبدءوا في دراسة الحمض النووي للنواة (أيْ كتلة المادة الوراثية المخزنة في النواة، مقارَنةً بالقدر الضئيل من الحمض النووي الموجود في الميتوكندريا) المأخوذ من عظامِ أقربِ السلالات شبهًا بنا (على الرغم من انقراضها)، أَلَا وهم النياندرتاليون. في هذه الحالة، يكون أخطر أنواع التلوُّث هو الحمض النووي المكشوط من أصابع الأشخاص الذين تعامَلوا مع العظام، حيث إن الحمض النووي للإنسان المعاصر أكثر شبهًا بالحمض النووي لإنسان النياندرتال من أية سلالة أخرى.
ولتحديد العينات الأقل تلوُّثًا بالحمض النووي للإنسان العاقل، فحَصَ بايبُو أولًا الحمضَ النووي الميتوكندري للنياندرتاليين، الذي أُخضِع للدراسة من قبلُ بالتفصيل. بدأ الباحثون بسبعين عظمة بالإضافة إلى أسنانٍ مأخوذة من عدة مواقع نياندرتالية، فاستطاعوا أولًا تحديد ستِّ عينات كانت الجزيئات الحيوية محفوظةً فيها جيدًا، وباستخدام تفاعُلِ البوليمريز المتسلسل، شرعوا في تحليل الكميات النسبية من الحمض النووي الميتوكندري المأخوذ من إنسان النياندرتال ومن الإنسان المعاصر في كلٍّ من هذه العينات. على الرغم من أنه في معظم العينات كانت الغالبية العظمى من الحمض النووي المُكتشَف تنتمي للإنسان المعاصر، فقد استطاع الباحثون تحديدَ عظمة واحدة — عُثِر عليها في كهف فينديجا في كرواتيا، ولهذا أُطلِق عليها «في آي-??» Vi-80 — كان الحمض النووي الميتوكندري للرئيسيات فيها عبارة عن مادة نياندرتالية شبه نقية. (لاحِظْ أن هذه العينة من الحمض النووي لا تزال تحتوي على كمياتٍ هائلةٍ من الحمض النووي البكتيري وربما الفطري، ولكن هذه الكميات من السهل نبْذُها خلال عملية تحديد التسلسل النووي.) لتحليل هذه العظمة الثمينة، استعان فريق لايبزيج بطريقة جديدة تمامًا لم تُسهِم فقط في تسريع العملية بمعدل الضعف تقريبًا، وإنما مكَّنَتْهم أيضًا من متابعة كلِّ مقطع على نحو مستقلٍّ؛ كي يعرفوا — على سبيل المثال — الموضع الذي تنتمي له أي قطعة على أي من جديلتَي اللولب المزدوج.
صمَّمَ هذه الطريقةَ الجديدة جوناثان روثبِرج وزملاؤه من شركة «??? لايف ساينسيز» في ولاية كونيتيكت، وهي تعتمد على دمج قاعدة معينة خلال عملية تخليق الجديلة المُكمِّلة، وعلى إنتاج البيروفوسفات (ولهذا السبب يُعرَف باسم التسلسل الحراري pyrosequencing، ولا علاقة له بالألعاب النارية pyrotechnics). طوَّرَ فريقُ روثبِرج نظامًا مدمجًا كاملًا يستطيع تنفيذَ هذا النوع من التسلسل باستخدام الجدائل الأحادية الثابتة للحمض النووي في ثقوب تفاعُل حجمها بيكولتر (????? لتر). تعمل هذه الطريقة على نحوٍ أفضل مع المقاطع التي يبلغ طولها حوالي ??? قاعدة. وفي دورة واحدة لا تستمر أكثر من ? ساعات، يستطيع النظام الأوتوماتيكي تحديدَ تسلسل ?? مليون قاعدة، مثلما أوضح روثبِرج بتحديد تسلسل «الميكوبلازما التناسلية» مجدَّدًا. وفي عام ????، كانت هذه البكتيريا هي السلالة الثانية التي يُحدَّد تسلسُل جينومها كاملًا.
جاءت هذه الطريقة التسلسلية الجديدة في أوانها المناسِب للاستفادة منها في مشروع بايبُو. فالمحصلة النهائية أنها تعمل أسرع ??? مرة، وبدقة أعلى من طريقة سانجر التقليدية التي تُستخدَم الآن على نحوٍ روتينيٍّ، مع الاستعانة بالترحيل الكهربائي الشعيري وصبغات الفلورسنت للاهتمام بعمليتَي الفصل والرصد، على التوالي. عيب التسلسل الحراري أنه لا يصلح مع المقاطع الأكبر من ??? قاعدة، ولا أهمية لهذه النقطة بالنسبة إلى الباحثين المهتمين بالجينوم القديم أمثال بايبُو؛ حيث إن عينات الحمض النووي التي يحلِّلونها تُقطع بالفعل إلى أجزاء صغيرة عندما تصل إلى المعمل، ونادرًا ما يبلغ طولها ??? زوج قاعدي.
وهكذا، استطاع فريق لايبزيج البحثي بكل سعادة الإعلانَ عن أحدث تقنية تسلسلية للكشف عن أسرار العظام القديمة. في الجزء الأول من مشروعهم، حدَّدوا التسلسلَ النووي لحوالي ربع مليون مقطع حمض نووي مختلِف مأخوذ من عظمة «في آي-??»، وحاولوا نسبتَها إلى مجموعة كبيرة من الكائنات الحية بمقارنتها مع التسلسلات الجينومية المسجَّلة في قواعد البيانات الحالية. لكن باءَتِ المحاولةُ بالفشل مع ??? ألف تسلسُل نووي؛ فمن بين الخمسين ألفًا التي أمكن تصنيفها، اتضح أن ?? ألفًا تنتمي لبكتيريا التربة، من الفصيلة المعروفة باسم الحارش «الأكتينومايسليز».
بَيْدَ أن ثاني أهم المجموعات كانت مجموعة الحمض النووي للرئيسيات، الذي يتكوَّن من ????? مقطع متسلسل يُفترَض أنه ينتمي لإنسان النياندرتال، اختار الباحثون من بينها أولًا تسلسلاتِ الحمض النووي الميتوكندري البالغ عددها واحدًا وأربعين؛ لكي يُطَمئِنوا أنفسهم (مجدَّدًا) بأن الحيوان المنتمي للرئيسيات والخاضع للبحث لم يكن مجرد «إنسان عاقل». اجتازَ الواحد والأربعون تسلسُلًا جميعًا هذا الاختبارَ بنجاح. علاوة على ذلك، أثبَتَ تحليلُ هذه المقاطع فائدتَه في زيادة المعرفة الحالية بشأن الحمض النووي الميتوكندري لإنسان النياندرتال، وقدَّمَ تقديرًا تقريبيًّا حول الوقت الذي انفصلت فيه السلالتان البشريتان إحداهما عن الأخرى. فطبقًا لهذه العينات، حدَثَ الانفصالُ منذ ما يتراوح بين ??? ألف سنة و??? ألفًا مضت.
بهذا التأكيد، التفَتَ الباحثون إلى الهدف الرئيسي لبحثهم، وتحديدًا الحمض النووي غير المُستكشَف بعدُ، الموجود في نوى الخلايا النياندرتالية. في نوفمبر ????، أعلَنَ فريق بايبُو عن أول مليون زوج قاعدي للجينوم النياندرتالي، يغطي نسبة ?????? من الجينوم بأكمله، وكان الناتج أقلَّ بعض الشيء في حالة الكروموسومات الجنسية، ولكن بما أن المقطعين «إكس» و«واي» تمَّ تحديدهما، فمن المؤكَّد أن «في آي-??» ينتمي لذكرٍ نياندرتاليٍّ. كان المليون الأول بالطبع مجرد علامة مرجعية تمَّ تحديدها عشوائيًّا، وقد واصَلَ الباحثون بعد ذلك تحديدَ التسلسل النووي لمزيدٍ من المواد.
بناءً على أول مليون زوج قاعدي، استطاع باحثو لايبزيج بالفعل عقْدَ مقارنات تفصيلية بين تسلسلات الجينوم المعروفة لسلالتنا وتسلسلات جينوم الشمبانزي الشائع من نوع «بان تروجلودايتس» (انظر الجزء الوارد تحت عنوان «شجرة العائلة» في مقال «أبناء عمومتنا المُشعِرون»). وبالطبع، فإن الغالبية العظمى من قواعد الحمض النووي متطابِقة في السلالات الثلاث جميعها.
باستخدام جينوم الشمبانزي كمقياس خارجي، استطاع الباحثون أن ينسبوا سببَ الاختلافات بين البشر المعاصرين والنياندرتاليين إلى التغيُّر التطوُّري لأحدهما. على سبيل المثال، تختلف مادتنا الوراثية في ??? موضعًا (من بين المليون موضع التي أُخضِعت للدراسة) عن الاتفاق الموجود بين النياندرتال والشمبانزي. إذا افترضنا أن معدلات الطفرات في «الكائنات العاقلة» و«الكائنات النياندرتالية» كانت متشابِهةً، فلا بد أن يوجد قدرٌ مماثِلٌ من الاختلافات بين النياندرتاليين من ناحيةٍ، والاتفاق بين الشمبانزي/البشر من ناحية أخرى.
إلا أن ما اكتشفه الباحثون هو أن الحمض النووي النياندرتالي يتَّسِم فيما يبدو بطفرات معيَّنة تزيد ثماني مرات عن طفرات الحمض النووي للإنسان المعاصر. وكان تفسيرهم للأمر أن حوالي سبعة اختلافات من واقع كل ثمانية موجودة حصريًّا في الحمض النووي النياندرتالي؛ قد ترجع إلى التلف الذي تعرَّضَ له الحمض النووي القديم خلال عشرات الآلاف من السنوات التي قضاها في الأرض. وحتى اليوم الذي يصبح فيه حمضٌ نووي مأخوذٌ من أفراد نياندرتاليين آخَرين متاحًا من أجل إخضاعه للمقارنة، لا يملك العلماء خيارًا سوى التغاضي عن هذه الطفرات المفترَضة، والتركيز على الاختلافات المحدَّدة القاصرة على الجينوم البشري المعاصر، الذي يستطيعون فحصه بسهولةٍ بقدر ما يرغبون.
بناءً على مقارنة التسلسلات النووية بين هذه الجينومات الثلاثة المتشابهة، قدَّر بايبُو وزملاؤه أن وقت انفصال إنسان النياندرتال والإنسان المعاصر أحدهما عن الآخَر، كان منذ ??? ألف سنة قبل زماننا. ولكنهم أشاروا إلى أن هذا الرقم يحتمل الخطأ فيما يتعلَّق بوقت انفصالنا عن حيوانات الشمبانزي، الذي من المفترض أنه كان منذ ??? ملايين سنة مضَتْ، وبالتالي يجب ألَّا يُنظَر إليه باعتباره حقيقةً مُسلَّمًا بها.
كما قدَّمت الدراسة المبدئية لأول مليون زوج قاعدي معلوماتٍ عن حجم التجمُّعات المؤسِّسة. فعلى عكس حيوانات رئيسية أخرى، فإن كلًّا من إنسان النياندرتال و«الإنسان العاقل» ينحدر فيما يبدو من تجمعات صغيرة نسبيًّا تبلغ حوالي ?? آلاف فرد، وتُعَدُّ أيضًا البيانات المتاحة عن النياندرتاليين مفيدةً للباحثين المهتمين بأصول التنوُّع الجيني للإنسان. ثمة مواضع عديدة في الجينوم البشري لا يوجد بها اتفاق، ولكن وُجِد أن هناك صورًا عديدة واسعة الانتشار. وإذا تضمَّنَتْ هذه الصور زوجًا قاعديًّا واحدًا، فسيشار إليها بأنها التغيُّرات الفردية المتعدِّدة الأشكال للنيوكليوتيدة. وبالنظر إلى كلٍّ من إنسان النياندرتال والشمبانزي بصفتهما نقطتين مرجعيتين، فمن الممكن الآن اكتشاف أيُّ نسخة من صورة بشرية معينة هي النسخة «الأصلية» وأيُّها هي الطفرة. وفي بعض الحالات، بالطبع، قد ينتج التغيُّرُ حتى قبل الانفصال عن النياندرتال.
بالتزامن تقريبًا مع بحث بايبُو في مجلة «نيتشر»، ظهرَتْ دراسة ثانية عن جينوم النياندرتال في مجلة «ساينس» المنافسة، قام فيها إدوارد روبين وزملاؤه في العديد من المعاهد البحثية في أرجاء الولايات المتحدة بتحليل الحمض النووي المأخوذ من نفس العظمة بأسلوبٍ مختلفٍ بعض الشيء؛ فقد حدَّدوا تسلسُلَ ????? زوج قاعدي فقط، ولكنهم اختاروها سلفًا، وبالتالي ربما توصَّلوا إلى قدرٍ من البيانات المهمة مماثِلٍ لما توصَّلَ إليه باحثو لايبزيج الذين فحصوا مقاطع الحمض النووي عشوائيًّا. وتباينت استنتاجات روبين المبدئية عن بايبُو في بعض الجوانب الرئيسية، مثل تاريخ الانفصال واحتمالية الاختلاط الوراثي بين السلالتين.
بناءً على هذه النتائج المبدئية والجدوى المثبتة للجينوم النياندرتالي، اقتنَعَ بايبُو وزملاؤه الآن بأنَّ تحديدَ التسلسل النووي للجينوم بأكمله صار في متناول أيديهم. وهم يرون أن المقارنات الجينومية الكاملة بيننا وبين أبناء عمومتنا من النياندرتاليين والشمبانزي ستكشف عن نتائج غير مسبوقة حول التطور البشري والتنوع البيولوجي. وستتضمن المقارنات أيضًا — بخلاف تحليل الاختلافات البسيطة مثل التغيُّرات الفردية المتعددة الأشكال للنيوكليوتيدة — أنواعًا أخرى من التنوع البيولوجي، بما في ذلك اختلافات عدد النُّسَخ، التي لم يبدأ العلماء في تقدير أهميتها إلا مؤخرًا.
بالنسبة إلى ظهور أبناء عمومتنا الأقرب شبهًا بنا واندثارهم، فثمة جدل دائر حول إن كان كلٌّ من إنسان النياندرتال والإنسان البدائي قد احتكَّ أحدهما بالآخَر بعد انفصال السلالتين إحداهما عن الأخرى، وما إن كان قد حدث أيُّ تبادُلٍ جيني، وما إن كان للإنسان أيُّ دور فاعل في انقراض النياندرتال. سيكون من الأسهل تقييم جميع هذه الأسئلة الجوهرية بمساعدة مقارنات جينومية كاملة. ويقدِّر بايبُو أن هذا الحلم قد يتحقَّق بحلول عام ????.
(????)
أحدث التطورات

في سبتمبر ????، انتشر جدال واسع حول احتمالية التلوث البشري في عينات بايبُو. وقد نحتاج إلى وضع المزيد من الضوابط لنوضِّحَ كَمْ من البيانات الأصلية يمكن اعتباره نياندرتاليًّا بنسبة ????. وفي الوقت نفسه، كان من المتوقَّع أن يتأخَّر تحديدُ تسلسل الجينوم بأكمله حتى عام ???? بسبب هذه المشاكل.
في بحثٍ منفصلٍ نُشِر في نفس الشهر، أدَّى الاستخدام المُبتكَر للكربون في تحديد العمر إلى مساعدة الباحثين عند إعادة فحص وتدقيق أسباب الانقراض المفترضة للنياندرتاليين في مواجهة الأحداث المناخية (بدلًا من ربط الاثنين بالزمن، وهو ربطٌ يعتريه الكثيرُ من الشكوك والأخطاء). ويبدو من التحليل الجديد أنه ليس ثمة علاقة واضحة بين التغيُّر المناخي واندثارِ النياندرتال.
كما أن تكنولوجيا تحديد التسلسل النووي المذكورة في هذا البحث هي نفسها التي ساهمَتْ في إكمال واحد من أوائل الجينومات الشخصية، أَلَا وهو جينوم جيمس واطسون. أعلمُ أن هذا مثارُ سخريةٍ لدى البعض، ولكني سأترك لكم الحكمَ.
لقاءٌ مع العائلة

كان النياندرتاليون أكثر السلالات شبهًا بنا في شجرة العائلة البشرية. ومنذ حوالي نصف مليون سنة، ظهر النياندرتاليون بصفتهم سلالةً منفصلة عن سلالتنا عندما انتقلوا إلى أوروبا وتأقلموا مع المناخ البارد، في حين بقي أسلافنا في أفريقيا لبعض الوقت. وبالتالي، فإن الفترة التطورية بين هاتين السلالتين تساوي تقريبًا عُشْر الفترة التي تفصل بيننا وبين الشمبانزي.
الاسم مشتق من وادي نياندرتال بالقرب من مدينة دوسلدورف بألمانيا، حيث وُجِد أثر لهم منذ ??? سنة. لكن مع الأسف تحطَّمَ هذا الهيكل النياندرتالي الأول؛ فالكهف الذي كان يوجد فيه انهار خلال استخراج الحجارة، واكتُشِفت العظام الأولى في الأنقاض، ولم ينجح الباحثون في تقفي أثر بقايا المادة وإنقاذ المزيد من العظام إلا في تسعينيات القرن العشرين.
كان الاكتشاف الأصلي يضمُّ الجمجمةَ، التي صُنِّفت بعد بضع سنوات باعتبارها منتميةً لسلالة جديدة بسبب النتوءات المميزة الموجودة فوق العين، والجبهة المرتدة إلى الوراء. منذ ذلك الحين، اكتُشِف العديد من العينات في أرجاء أوروبا والشرق الأوسط. عادةً ما توجد هياكل النياندرتال معًا وهي تحمل أنواعًا معينة من الأدوات الحجرية، المعروفة بالموستيرية (نسبةً إلى موقع «لو موستير» في منطقة دوردونيي بفرنسا).
منذ حوالي ?? ألف سنة، انتقل الإنسان المعاصر من أفريقيا إلى أوروبا. ومنذ ?? ألف سنة تقريبًا، انقرَضَ النياندرتاليون، في حين ازدهر أسلافنا، الممثلون من خلال اكتشاف إنسان الكرومانيون وغيره. وكان التحدِّي الأكبر بالنسبة إلى علم الأنثروبولوجيا المعنِيِّ بدراسة الإنسان هو اكتشاف ما حدث خلال هذه السنوات البالغ عددها ?? آلاف سنة. هل تراجَعَ النياندرتاليون هربًا من منافسيهم المتفوقين عليهم تكنولوجيًّا؟ هل يمكن أن يكون أسلافنا قد أبادوهم مباشَرةً؟ إلى متى دام التعايُش بينهم في أوروبا؟ وهل كان ثمة أيُّ اتصال أو حتى تزاوُج بينهم؟
في عام ????، اكتُشِفت أدوات موستيرية في كهفٍ بجبل طارق يعود تاريخها إلى ?? ألف سنة قبل زماننا. يوحي هذا الاكتشاف بأن أواخِر الناجين من هذه السلالة قد وجدوا مأوًى لهم في جبال جنوب إسبانيا، وأن التعايُشَ ربما يكون قد استمرَّ لمدةٍ أطول مما اعتقد العلماء سابقًا.
حتى الافتراض — الذي يُسقِطه معظم الخبراء من الحسبان — بأن الهيكل الذي يرجع إلى ????? سنة مضت لطفلٍ من لاجار فيلو (البرتغال) ربما يكون هجينًا بين إنسان النياندرتال والإنسان المعاصر؛ قد اكتسَبَ المزيدَ من المصداقية بعدَما تمَّ اكتشافُه في جبل طارق. هذا، وتظل قصة أبناء عمومتنا لغزًا شائقًا.
كيفية العثور على بقايا نياندرتالية

في ظهيرة يومٍ حارٍّ من شهر يوليو، خرجتُ وابنتي (التي كانت تبلغ من العمر وقتذاك ?? عامًا) على مضضٍ من قطارٍ مكيَّفٍ إلى الرصيف القائظ، وفيما يبدو كنَّا عالِقين في منطقة مجهولة، في مكانٍ ما بجنوب إسبانيا. فقط عندما غادَرَ القطارُ استطعنا أن نرى أنه كانت توجد بالفعل محطة صغيرة على الجانب المقابِل من خط السكة الحديدية، وأن عالِمًا في أصول الإنسان القديم وتطوُّره — يسهل التعرُّف عليه من صورة الجماجم البشرية الموجودة على قميصه — كان في انتظار مقابلتنا. لقد جئنا إلى هذه البقعة النائية لكي نتطوَّع في التنقيب في موقع أحد الكهوف، حيث تمَّ العثورُ على عشرات البقايا النياندرتالية على مدار السنوات العشر الماضية. لم يتطلَّب منا الأمرُ خبرةً سابقة، وكان يتضمَّن أربعَ وجبات وسكنًا أشبه بنُزُل الشباب. ومن هنا بدأت المغامرة.
ضاع يوم الثلاثاء الذي وصلنا فيه بسبب تغيير الحراسة. كان يوجد فريق آخَر من المتطوعين مكوَّن من ?? فردًا قويًّا يعملون في كهف مختلف في أقصى الشمال لمدة ثلاثة أسابيع، وقد جاءوا ليروا «كهفنا» قبل أن يرحلوا. كانت معنوياتهم مرتفعةً بعد اكتشافهم فأسًا حجريَّة في موقعهم؛ مما جعل الخبر يظهر على التليفزيون المحلي. وفي وقت الغداء، لم يكن يوجد سوانا من الأشخاص الجُدد على المائدة، ولكن بحلول وقت العشاء، كان الراغبون في الرحيل قد رحلوا ومعظم القادمين الجُدد قد ظهروا. كان من المفترض أن يكون الأربعاء يومَ عملٍ، بَيْدَ أن البروفيسور كان مشغولًا بمهامَّ أخرى؛ لذا خرجنا في جولةٍ بقيادة أحد المرشدين في موقع التنقيب وبضعة كهوف أخرى في نفس الجبل. كان الكهف بصفة أساسية عبارة عن حفرة عمودية عميقة في الصخور الكلسية، وكان كبيرًا بما يَسَع سقَّالة بناء، ويسهل الدخول إليه عبر نفق أفقي حفره عمَّال المناجم، أو عبر الطرف العلوي.
ولأننا كنَّا مستمتعين فعلًا بالتسلُّق إلى مدخل الكهف — على عكس البعض — حظينا بفرصة لنكون جزءًا من أول فريق مكوَّن من ثلاثة حفَّارين يعمل في موقع التنقيب نفسه، الذي يُدار من قمة السقالة، تحت المدخل مباشَرةً. تدخل الموادُّ إلى الكهف بواسطة البكرات، ثم تُحمَل بعد ذلك إلى الخارج عبر مخرج عمَّال المنجم. في «الفتحة العلوية» توجد ساحَتَا حفر، تمَّ كشفهما ببطء بواسطة المجارف الصغيرة، تبلغ مساحة كلٍّ منهما مترًا مربعًا واحدًا. وفي الرسابة المُفكَّكة نسبيًّا تنتثر العظام، ولكن للأسف معظمها ينتمي لحيوانات صغيرة مثل الأرانب. ومن النادر العثور على قطع صغيرة من عظام الغزلان والسلاحف. لم نجد أثرًا للبشر أو غيرهم من الحيوانات الكبيرة آكلة اللحوم في يومنا الأول. تتجه العظام التي يتم تجميعها خلال عملية التنقيب إلى حوض مسطَّح، بينما يخرج كلُّ شيء آخَر بواسطة البكرة في دِلاء، ليتمَّ تجميعه في أكياس في السفح.
وبما أنه يستحيل علينا مع درجة الحرارة المرتفعة العملُ في الموقع بعد الساعة الثانية عصرًا، امتدت استراحة الغداء وتضمَّنت زيارةً لحمام السباحة، وإتاحةَ وقتٍ لنوم القيلولة. وبنهاية فترة الظهيرة، عُدنا إلى العمل وأخذنا الأكياس من موقع التنقيب إلى الخطوة التالية، وهي الغربلة. يتم هذا في مصنع الرخام الموجود على الجانب الآخَر من الجبل، حيث يوجد خرطوم خاص مزوَّد برشاش ماء قوي، يساعد في تفتيت التراب وتمريره عبر مجموعة من ثلاثة غرابيل يتفاوت حجم شبكتها. ثم فحصنا الغرابيل، وجمعنا كلَّ العظام، وأي شيء يمكن أن يكون أداة حجرية، وحتى أصداف الحلزون. ولم تكن الأخيرة مهمةً في حدِّ ذاتها، ولكنها مهمة من أجل عينات التربة التي تغلِّفها. تتجه جميع هذه الاكتشافات بعد ذلك إلى الأحواض المسطحة، وتُوضَع عليها بطاقات تحمل تاريخها وموقعها الأصلي، ولكن لا يزيد تصنيفها عن هذا الحد.
الجمعة هو يوم الاحتفال المحلي بالقديس الراعي؛ ولهذا كان مصنع الرخام مُغلَقًا وتوقَّفَتِ الغربلة الرطبة، واستعضنا عنها بتركيبِ غربال جافٍّ عملاق عند مدخل عمَّال المنجم وغربلنا الركام الملقَى هناك. تُعتبَر مثل هذه المادة المستعملة أقلَّ قيمةً؛ لأنها تفتقر إلى السياق الجيولوجي الدقيق، ولكن من ناحية أخرى، يمكن للمرء معالجتها بسرعة والعثور على عظام أكثر وأكبر بأقل مجهود. ويجب ألَّا ننسى أن تلك الاكتشافات الكبرى قد وُجِدت في نفايات الآخَرين؛ ففي الموقع النياندرتالي، حيث عثَرَ عمَّال المحجر على قُبَّة الجمجمة الأصلية التي قادَتْ إلى تعريف السلالة النياندرتالية، أثمرَتْ إعادةُ الفحص الجديدة للتربة التي رماها أولئك العمَّال عن ثروة من البقايا النياندرتالية. حسنًا، يحقُّ للمرء أن يحلم، أليس كذلك؟! بالتحديد في هذه الكومة من الأنقاض عثرنا على بقايا من قرون الوِعال، وأصداف سلاحف، وجزء من حجر شديد الصلابة، ولكننا لم نجد عظامًا بشرية.
في وقت متأخِّر من ظهيرة يوم الجمعة، عرفنا آخِر خطوة من هذه الإجراءات، وهي فرز الاكتشافات وتصنيفها. إذ يوجد أكثر من ?? تصنيفًا مختلفًا، فيما يخص العظام والأسنان المحترقة أو غير المحترقة، لحيوانات صغيرة أو كبيرة، قابلة للتصنيف أو غير قابلة للتصنيف. النوع غير القابل للتصنيف هو الخيار الشائع، حيث إن جميع العظام في تلك الكومة — التي عادةً ما تكون أجزاءً من جسم العظمة دون مفصل أو شكل محدَّد يتيح التعرُّف على أصلها — ستُوضَع في كيس بلاستيكي واحد، ولن يُنظَر إليها مرةً ثانية. وعلى العكس من ذلك، يجب وضع كلِّ عظمة من العظام القابلة للتصنيف في كيس بلاستيكي صغير منفصِل يحمل اسمها. وانتهت مهمتنا عند تعبئة الأكياس وعدِّها ودمجها في أكياس أكبر، ولكن سيضطر بعض علماء الأحياء التعساء ذاتَ يومٍ إلى فحصِ جميع العظام القابلة للتصنيف مرةً ثانية وكتابةِ التقارير التي ربما يستطيعون إخبارنا بها. يبدو أن الكهف لم يكن مأوًى للنياندرتاليين فقط، ولكنه كان يأوي أيضًا بعض الحيوانات الأخرى آكلة اللحوم، مثل الثعالب والبوم. وبناءً على الوفرة النسبية للعظام المتنوعة (على الرغم من ندرة الفقاريات إلى حدٍّ يثير الشك)، قد يستطيع الباحثون اكتشافَ مَنْ أكل مَنْ ومتى.
بعد عملية التصنيف، عقد البروفيسور محاضَرةً حول المجهود السابق في كلا الموقعين، وعرض بعضَ الأجزاء من البقايا البشرية التي اكتُشِفت سابقًا، والفأسَ الحجرية الأصلية التي اكتُشِف منذ أسبوعين، وكانت رؤية الفأس الحجرية (وهي عبارة عن قطعة حجرية شبه بيضاوية بحجم قبضة اليد، وبعض أجزائها مكشوطة عند الزوايا، في حين أن طرفها الحاد مكسور) بمنزلة صدمة بالنسبة إلى معظمنا. تخيَّلْ أن هذا الشيء كان وسط التراب، إنني متأكِّد أننا لم نكن لندرك أنه أداة (الشخص الذي اكتشَفَه لم يتعرَّف عليه هو أيضًا)، وأعتقد أنني ربما أكون قد ألقيْتُ خمسَ فئوس حجرية خلال الغربلة الجافة. حسنًا، أنا متأكِّد أن شخصًا آخَر سيجدها عندما يغربل ركامنا.
عُرِض علينا يوم السبت القيام بجولةٍ في الموقع الآخَر، بالإضافة إلى أثر روماني ومنزل مستدير نيوليتي اكتُشِف حديثًا. وفي يوم الأحد، ظلَّ مصنع الرخام مغلقًا؛ ولهذا قمنا في هذا اليوم أيضًا بالغربلة الجافة والتصنيف، ولم نَرَ فئوسًا حجرية، مع أننا أصبحنا على علمٍ الآن بالشكل الذي من المفترض أن تبدو عليه.
الإثنين هو يوم عملنا الأخير، حيث كنَّا قد حجزنا الأسبوع الأول فقط من عملية الحفر المستمرة لمدة ثلاثة أسابيع، وأول ما فعلناه في الصباح هو الذهاب مجدَّدًا إلى ساحات التنقيب مع متطوِّع حديث القدوم، وقد حالَفَه الحظُّ واستطاع العثورَ على رأس عظم الفخذ، وهو الطرف المستدير من عظم الفخذ، الذي يدخل في مفصل الوَرِك. هذا الرأس قد ينتمي لإنسانٍ، ولكن من ناحيةٍ أخرى، قد ينتمي لأي حيوان ثديي آخَر كبير الحجم؛ لذا سيكون على علماء الأحياء إلقاء نظرة أدق على هذه العظمة.
في الظهيرة، عُدنا إلى مصنع الرخام لنفحص الغرابيل الرطبة. تأخَّرَ الوقت بنا، وبينما كنا نبدأ في التعامل مع آخِر غربال، إذا بابنتي تضع يدها داخله وتنتشل شيئًا أبيض بعض الشيء مقارَنةً بالصخور والتراب، وسألتني: «ربما تكون هذه سنًّا بشرية، أليس كذلك؟» وبصفتي شخصًا غير متخصِّص مهتمًّا بالتشريح، اعتقدت أنها ربما تكون كذلك، ولكنني لم أكن واثقًا في حكمي؛ لهذا الْتَفتُّ إلى المساعِد الواقف بالقرب مني وطرحت عليه نفس السؤال، فنظر إليَّ كما لو كان واثقًا تمام الثقة أنني أحاول أن أمزح معه، ثم نظر إلى السن فتغيَّرت تعابير وجهه، وقال: «في واقع الأمر، بلى، إنها سن بشرية.» وبالطبع فحصنا عن كثب كلَّ ذرة تراب في هذا الغربال المحظوظ، ولكن حتى نهاية الأسبوع الأول ظلَّتْ هذه السن الاكتشافَ النياندرتالي الوحيد القاطع. وفي يوم الثلاثاء، انطلقنا إلى الشاطئ، ولكن بقيةَ الأفراد كان لا يزال أمامهم أسبوعان آخَران لاكتشاف المزيد من بقايا تلك السلالات التي لديها أسنان كأسناننا.
(????)
قراءات إضافية

M. Krings et al., Nature Genet., 2000, 26, 144.
M. Margulies et al., Nature, 2005, 437, 376.
R. E. Green et al., Nature, 2006, 444, 330. (one million base pairs)
J. P. Noonan et aI., Science, 2006, 314, 1113. (62,500 base pairs)
R. Redon et al., Nature, 2006, 444, 444.
C. Finlayson et al., Nature, 2006, 443, 850.

الفصل الحادي والعشرون
تَناوَلِ النظائرَ وعِشْ طويلًا!


غالبًا ما تجدني المقالاتُ المثيرة قبل أن أجدها؛ فالباحث صاحبُ المقال التالي تواصَلَ معي وأقنعني أن أفعل شيئًا حيال الأمر. تردَّدت في البداية بما أنني غير مقتنع مطلقًا بجدوى إطالة عمر الأغنياء بينما يظل الفقراء يموتون قبل الأوان لأسبابٍ يمكن تلافيها تمامًا. ومع هذا، فبما أن المنطق العلمي الكامن وراء هذا المقال بَدَا مُقنِعًا، كما أن الموضوع بَدَا يقينًا أنه ربما يكون مثار اهتمام قطاع عريض من الجمهور؛ تقبَّلْتُها في نهاية المطاف وكتبتُ خبرًا يضمُّ بعض التحذيرات. وفي تلك الأثناء نفسها، نشر زميل أقل تقيُّدًا خبرًا أشد حماسًا لمجلة أخرى، مصحوبًا ببيان صحفي تناقلَتْه وسائل الإعلام في جميع أرجاء العالم، وهذا معناه أن المقال قد جذب الانتباه؛ مما يجعل متابعته أمرًا ممتعًا.
اقترح باحث من جامعة أكسفورد أن النظائر الثقيلة والمستقرة في الوقت نفسه مثل الدُّوتيريوم والكربون-?? يمكن أن تُستخدَم لإعاقة تفاعلات التقدُّم في العمر التي ترتبط بالسلالات المتفاعلة مع الأكسجين.
تُعتبَر السلالات المتفاعلة مع الأكسجين مادة لأبحاث التقدُّم في العمر؛ إذ يُعتقَد أنها تسبب ضررًا تراكميًّا للمخزون الجزيئي في الخلية. وقد اقترح حاليًّا الباحثُ ميخائيل شيبنوف من جامعة أكسفورد أن الأطعمة التي تحتوي على النظائر الثقيلة، كالهيدروجين والكربون والنيتروجين في مواضع رئيسة، يمكن أن تقلِّل إلى حد كبير الضررَ المؤكسِد، أو حتى تتفاداه كليةً.
تعتمد حجة شيبنوف على كيمياء العمليات التي تتعرَّض من خلالها الجزيئاتُ الحيوية، مثل الحمض النووي والبروتينات والليبيدات، إلى الضرر المؤكسِد في الخلية. في العادة، تتمثَّل الخطوة التي تقيِّد معدل هذا التفاعل في طرد الهيدروجين من ذرة الكربون التي ستتم أكسدتها. إذا استُبدِلت بالكربون و/أو الهيدروجين نسخةٌ أثقل من نفس العنصر (مثل الكربون-?? أو الدُّوتيريوم)، فسيتباطأ التفاعل. وتُعرَف هذه الظاهرة المُثبتة باسم تأثير النظير الحركي.
كيف ينقل المرء هذه النظائر إلى المواقع الحيوية في الخلية؟ يصبح الأمر أسهل عندما تكون العناصر الأساسية الجزيئية محل الاهتمام موادَّ مُغذيةً ضرورية؛ مما يعني أن الجسم لا يستطيع تخليقها من الصفر ويجب تناولها في الطعام. وبعض الأحماض الأمينية التي تُعتبَر أهدافًا معروفة للضرر المؤكسِد في البروتينات تُعَدُّ أيضًا موادَّ مُغذيةً ضرورية؛ مما يوحي بإمكانية حمايتها بمساعدة تأثير النظير. والوضع مماثِل بالنسبة إلى الليبيدات (المشتقة من الأحماض الدهنية الضرورية).
ومع هذا، فالأحماض النووية هدف أشد صعوبةً؛ لأن عناصرها الأساسية يمكن تخليقها في الجسم. إلا أن شيبنوف يرى أن هذه الجزيئات ضرورية على نحوٍ مشروط؛ مما يعني أنها قد تصبح ضرورية في مواقف معينة (كما في حالة ما بعد الصيام مثلًا).
يثق شيبنوف — الذي قدَّمَ بالفعل طلباتِ براءةِ اختراعٍ عديدةً بخصوص هذا المنهج — بأن هذا هو السبيل إلى تمتُّع الإنسان بمدة حياة مديدة وموفورة الصحة، ويقول في هذا الشأن: «كانت التجارب البيولوجية الأولى التي أُجرِيت في روسيا واعدة للغاية.» مع أنه لم يُرِدْ إفشاءَ أيِّ تفاصيل بعدُ.
لا تقلقه أيضًا الحقيقة المعروفة بأن الماء الثقيل سامٌّ بالنسبة إلى الكائنات الحية الراقية؛ فهو يرى أن «النظائر لن تندمج إلا في المواضع التي تحتاج إلى حماية من الأكسدة. ومن الناحية النظرية، فإنها تبطئ تفاعل الأكسدة لدرجة أنها لن تتحرَّرَ لتشترك في تفاعلات أخرى. وإذا انفصل بعضها، فسيكون هذا بتركيزات منخفضة للغاية.»
ومع هذا، فإن تحويل هذه الفكرة إلى ممارسة صالحة للتطبيق تجاريًّا ستكون مسألة مختلفة. فبما أن الأحماض الأمينية المُعدَّلة يجب تخليقها بدلًا من زراعتها فحسب في أحد الحقول، فستكون الأطعمة الغنية بالنظائر باهظة الثمن للغاية بكل تأكيد مقارَنةً بالتي نأكلها الآن. ولكي يكون لها تأثير على تقدُّم العمر، سيكون من اللازم توافر الطعام الغني بها على مائدة الطعام كلَّ يوم، طوال حياتنا، وقد ينتهي الأمر بأن الأشخاص الفاحشي الثراء فقط هم مَن ستكون لديهم القدرة على شرائه. ولأن الأغنياء قليلون، باعتراف الجميع، فنحن كمجتمع قد لا نرغب في توسيع فجوة متوسط العمر المتوقَّع بين الأغنياء والفقراء أكثر مما هي عليه.
حتى إذا أصبحَتِ الأطعمة الغنية بالنظائر في متناول الجميع، فقد يكون من الصعب بيعها لجمهورٍ يساوره القلق بالفعل تجاه المواد الكيميائية المضافة إلى الطعام، والمحاصيل المُعدَّلَة وراثيًّا، وأي تلاعُب آخَر بالطعام. وهكذا، فإن أغنياء العالم فقط، الذين يملكون أموالًا لا حصرَ لها واهتمامًا مرضيًّا بالخلود، هم مَن قد ينتهي بهم المطاف ببلوغ قرنٍ ثانٍ من حياتهم بفضل النظائر، بينما قد لا يفطن بقية العالم إلى ذلك.
ومع هذا، فمن الجائز أن تظهر أسواق متخصِّصة في مجال الأطعمة الغنية بالنظائر، ولعل السفر لمسافاتٍ طويلة عبر الفضاء هو أول ما يخطر على الذهن؛ فبما أن روَّاد الفضاء يتناولون الطعام المُخلَّق على أية حال، ومعرَّضون إلى ضرر أكسدة أكبر بسبب الإشعاعات، فمن المأمول أن تتاح الأطعمة الغنية بالنظائر بحلول الوقت الذي يسافر فيه أول رائد فضاء إلى المريخ.
(????)
قراءات إضافية

M. Shchepinov, Rejuvenation Res., 2007, 10, 47.

الفصل الثاني والعشرون
مرض خبيث من أعماق البحار


عندما ألَّفتُ كتابي «الحياة على حافة الهاوية» (عن الحياة في ظلِّ الظروف القاسية)، وضمَّنت فيه قسمًا عن بكتيريا المَعِدة «هليكوباكتر بيلوري» (انظر مقال «هل يمكننا هضم البكتيريا المعوية الموجودة في المَعِدة؟») شعرتُ بأنني أتحدَّى نفسي. صحيح أن بكتيريا «هليكوباكتر بيلوري» تتأقلم مع البيئة الشديدة العدائية، وأقصد بذلك مَعِدَة الإنسان، ولكن بما أن هذه البيئة بعيدة بعض الشيء عن البيئات البيولوجية الأخرى المذكورة في الكتاب، مثل الينابيع الساخنة في أعماق البحار والقارة القطبية الجنوبية، فإن هذه الأنواع المختلفة من الظروف القاسية لا بد أن تكون غير متصلة. وبعد عشر سنوات، اتضح أن ثمة رابطًا مذهلًا في الواقع بين البكتيريا الغريبة الأطوار التي تسبِّب قُرَحَ المَعِدَة وتلك التي تعيش بسلامٍ في قاع المحيط …
طوَّرَتِ البكتيريا المُخلَّقةُ كيميائيًّا التي تتغذى على البيئات البيولوجية المظلمة في أعماق البحار صفاتٍ مهمةً تعمل بمنزلة عوامل خبيثة في مختلف السلالات الشبيهة المسبِّبة للمرض، حسبما كشف التحليل الأول لجينوماتها.
تعتمد البيئات البيولوجية التي تحيط بالفتحات الحرارية المائية والينابيع الحارة في أعماق البحار على البكتيريا المُخلَّقة كيميائيًّا التي تحيا عادةً متعايشةً مع الحيوانات المقيمة في هذه البيئات، مثل: المحار والديدان الأنبوبية (انظر مقال «كيف تأكل دون مَعِدَة»). وقد كشفت التسلسلات الجينومية لاثنين من هذه الكائنات المتعايشة عن تشابُهات مدهشة مع البكتيريا المسبِّبة للمرض الشائعة في الإنسان، بما في ذلك سلالتا «هليكوباكتر بيلوري» (المسبِّبة لقُرَح المَعِدَة) و«كمبيلوباكتر» (المسبِّبة للتسمُّم الغذائي).
وحتى وقت قريب، قاومت المعايِشات الجوانية التي تعيش في أعماق البحار جميعَ محاولات استنباتها في مستنبت نقي، وهو ما يكون في العادة أول شيء يقوم به علماء الأحياء المجهرية قبل الشروع في توصيف سلالة جديدة وتسميتها. وكان على الباحثين أن يلجئوا إلى دراسة العينات الخام، كتلك المأخوذة من كيس التغذية للديدان الأنبوبية (انظر التعقيب على مقال «كيف تأكل دون مَعِدَة»).
نجح مؤخرًا فريقٌ بقيادة ساتوشي ناكاجاوا بمركز إكستريموبيوسفير للأبحاث في يوكوسوكا باليابان في جمع مستنبتات نقية لعدة سلالات من بكتيريا إبسيلون-بروتيوبكتيريا المأخوذة من مجتمعات بكتيرية تعيش في إحدى الفتحات الحرارية المائية، وهي التي يعتقدون بشدة أنها متعايِشة (مع أن تقنية أخذ العينات عن بُعْد لا تتيح لهم أن يُثبِتوا تحديدًا البيئةَ التي تعيش فيها هذه البكتيريا). وقد أكمَلَ الآن نفسُ الفريق التسلسلاتِ الجينومية لسلالتين من هذه السلالات، وتعرَّفوا عليهما بصفتهما عضوتين من جنس «سولفوروفوم» و«نيتراتيرابتور».
كشفت التسلسلات الجينومية — التي تمَّ تحليلها بالمقارنة مع الكمِّ الهائل من التسلسلات النووية في كلتا السلالتين القريبة والبعيدة — العديدَ من التفاصيل عن عمليات التكيُّف التي تتيح لهذه البكتيريا العيشَ في ظروفٍ فيزيائية قاسية وفي غياب التمثيل الضوئي؛ إذ إنه على غرار البكتيريا المأخوذة من الديدان الأنبوبية التي اكتُشِفت سابقًا في عام ????، تتمتَّع هاتان السلالتان بمجموعة الجينات الكاملة التي تُعتبَر ضروريةً لحدوث دورة كريبس على نحوٍ عكسيٍّ. وهي مجموعة تفاعلات رئيسية في الكائنات الحية الراقية، تستخدمها البكتيريا لكي تُنتِج جزيئاتٍ عضويةً، بدلًا من أن تهضمها (مثلما يحدث في دورة كريبس في جسم الإنسان).
ومع هذا، فممَّا يثير الدهشة على نحوٍ أكبر أن الباحثين حصلوا أيضًا على معلومات قيِّمة حول تكيُّف البكتيريا مع بيئة أخرى قاسية مختلفة تمامًا، وهي مَعِدَة الإنسان، حيث فُوجِئ ناكاجاوا وزملاؤه بالعثور على عدة جينات يُعتقَد أنها عوامل خبيثة خطيرة في سلالتَي البكتيريا المسبِّبتين للأمراض في الإنسان «هليكوباكتر بيلوري» و«كمبيلوباكتر»، اللتين تستطيعان العيش في البيئة العالية الحموضة التي تتسم بها مَعِداتنا. واستخلص الباحثون أن «ذاتية التغذية الكيميائية في أعماق البحار كانت أساسَ السُّميَّة في البكتيريا المُسبِّبة للأمراض لدى الإنسان والحيوان.»
من الشائع بالنسبة إلى البكتيريا المسبِّبة للأمراض أن تكتسِب صفاتٍ وراثيةً من سلالات أخرى، في عملية تُعرَف باسم الانتقال الجيني الأفقي. على سبيل المثال، البكتيريا العنقودية الذهبية المقاومة للميثيسيلين المروعة في المستشفيات هي سلالة من بكتيريا «العنقوديات الذهبية» التي اكتسَبَتْ جينًا إضافيًّا يُكسِبها مناعةً ضدَّ المضادات الحيوية مثل الميثيسيلين. وفي الغالب، توجد مثل هذه الصفات في الأجزاء المستديرة من الحمض النووي المُسمَّاة بالبلازميدات، التي تستطيع الانتقال بسهولةٍ حتى بين البكتيريا ذات السلالات المختلفة. وحتى إذا كان من النادر انتقالُ جينٍ محدَّد إلى مُستقبِل معيَّن، فإن وجود عائق تطوري مكافئ مثل المضاد الحيوي سيعطي المستقبِل ميزةً ويمكن أن تنتشر الصفة بسرعة.
ربما تكون العوامل الخبيثة المشتركة بين البكتيريا المُسبِّبة للأمراض في الإنسان وبكتيريا أعماق البحار قد انتقلت من أحدهما إلى الآخر بطرق مماثلة، ولكن هذا يتطلَّب على الأقل أن تكون أسلافها البعيدة قد عاشت بعضها بالقرب من البعض. أما عن مكان التقاء السلالتين بالتحديد وتبادلهما أسلحتهما، فلا يزال لغزًا شائقًا.
(????)
قراءات إضافية

S. Nakagawa et al., Proc. Natl Acad. Sci. USA, 2007, 104, 12146.

الجزء الثاني
علوم مثيرة


الجاذبية ليست مسئولةً عن وقوع الناس في الحب.
ألبرت أينشتاين إنني أكتب عن الجزيئات أكثر مما أكتب عن البشر، وهو أمر يفتقر إلى الحكمة إلى حدٍّ ما من الناحية الاقتصادية؛ نظرًا لأن عدد القرَّاء المهتمين بقصص البشر أكبر من عدد المهتمين بقصص الجزيئات. ولكن إذا شرعتُ (أو عندما أشرع) في الكتابة عن البشر، فلا بد أن يكون العلم جزءًا من القصة، مثل الكيمياء التي تجذب الأفراد بعضهم إلى بعض، أو النواحي الوراثية التي تجعلهم يتصرفون بالطريقة التي يتصرفون بها.
الرابط بين الكيمياء وعلم الوراثة هو بالطبع الجنس؛ إذ إن الأولى تؤدِّي إليه والثانية تنتج عنه. لذا فهذه هي حجتي الضعيفة كي أجمع العديدَ من المقالات التي تتنوَّع بين كيمياء الجاذبية وصولًا إلى الوراثة التي هي سبب اختياري لعنوان هذا الجزء؛ علومٌ مثيرة. لكن انتبهوا، توجد بعض المقالات التي اعتبرتُها مثيرةً دون سبب محدَّد.

الفصل الأول
استشعِر الحرارة!


دعونا نكن بسطاء ونستهل هذا الجزء المثير بالجنس الشديد السخونة، ولكن سيحتاج المُتلصِّصون إلى ميكروسكوب؛ لأن ما سنتحدَّث عنه هنا هو الجنس الميكروبي.
متعة الحب لا تدوم إلا لحظة، في حين تدوم لوعة الحب إلى الأبد، حسبما تريدنا كلمات الأغنية الفرنسية لجان بيير كلاري دو فلوريان أن نصدق. حتى إذا دامَتْ «لوعة الحب» إلى الأبد، فستظل هناك ميزة بيولوجية رئيسية يمكن الفوز بها من وراء استخدام التكاثر الجنسي. بالمقارَنة مع الانقسام الخلوي البسيط المصحوب بالطفرة العشوائية الغريبة، فإن اختلاط جينات الأبوين يتيح تنوُّعًا وراثيًّا أكبر يصاحبه استقرار أفضل للمستودع الجيني الجمعي للسكان. وبطريقة ما، يُعتبَر هذا سهلًا بالنسبة إلينا نحن الكائنات الراقية، بما أن مادتنا الوراثية منظَّمة على صورة أزواج كروموسومية عديدة؛ لهذا علينا فقط أن نتأكَّدَ من حصولنا على كروموسوم من الأب وآخَر من الأم. أما بالنسبة إلى النسخة التي نحصل عليها من هاتين النسختين، فهذه مسألة حظٍّ بحت؛ فقد يحمل الحيوان المنوي الذي يفوز في السباق أمام ملايين الحيوانات المنوية الأخرى الأُذُنَ الموسيقية لجدتك أو الأُذُنَ الكبيرة لجدك، وقد تلغي هذه الصفات الوراثية الجينات المقابلة المنحدرة من جانب الأم، أو تفقد أثرها وتبقى خامدة على مدار جيل كامل؛ هذا هو جوهر المسألة. أما بالنسبة إلى البكتيريا، فمسألة الحظ الجيني هذه أكثر تعقيدًا في تنظيمها؛ لأن جينومها يأتي عادةً في صورة جديلة حمض نووي مزدوجة واحدة، ولا يحدث الانتقال الجيني ما لم يتم قصُّ مقاطع الحمض النووي القصيرة من الجينوم ثم ترحيلها إلى مكان جديد بمساعدة الفيروسات أو حلقات الحمض النووي المتحركة المسمَّاة البلازميدات. وبالتالي، في حالة العديد من السلالات الميكروبية، بما في ذلك العتائق المُحِبَّة للحرارة بشدة (أليفة الحرارة العالية)، كان الجنس ممنوعًا.
لكن في عام ????، اكتشف دينيس جروجان من جامعة سينسيناتي النوعَ المناسِبَ من الإغراء الذي يجعل الميكروب المحِبَّ للحرارة والميكروب المحِبَّ للحموضة، اللذين ينتمي كلٌّ منهما إلى سلالة «سولفولوبوس أ??دو???دار?وس»، يحتكان أحدهما بالآخر احتكاكًا حميمًا. فاستنبت صورًا طافرة عديدة من البكتيريا العتيقة، التي احتاج كلٌّ منها إلى حمض أميني واحد أو مساعِد إنزيمي كمضافات غذائية لكي تحيا، بغض النظر عن المواد المُغذية الأساسية المتوافرة لها في أبسط وسيط. على سبيل المثال، السلالة الطافرة التي فقدَتْ قدرتَها على إنتاج الحمض الأميني هيستيدين من البداية، ستحتاج إلى وفرة من الهيستيدين في وسيط الاستنبات. ثم خلط جروجان سلالتين من هذه السلالات الطافرة وقام بتحضينها في وسيط لا يحتوي على أيٍّ من المضافات الغذائية المطلوبة، بل يحتوي بصفة رئيسية على حمض الجلوتاميك الأميني وحمض الكبريتيد المخفَّف. وعن طريق الانتقال الجيني فقط من سلالة إلى أخرى يمكن أن تنشأ سلالة جديدة تصبح قادرةً على النمو في وسيطٍ بلا مضافات غذائية. في واقع الأمر، اكتشف جروجان مثل هذه المستعمرات «المعافاة» كثيرًا، في حين أن التجربة الحاكِمة التي لم يحدث فيها خلطٌ بين السلالات بل تحضين على نحوٍ منفصِل في أبسط وسيط؛ نادرًا ما كانت تؤدِّي إلى طفرات معكوسة تُعِيد تشكيلَ النمط البري غير المعتمِد على المضافات الغذائية. والأمر الأكثر مثارًا للدهشة أن الانتقال الجيني، أو الجنس الميكروبي، كان يحدث بوضوحٍ في درجات حرارة تصل إلى ?? درجة مئوية.
كانت هذه هي أول مرة يحدث فيها تبادُل للمادة الوراثية بين الخلايا البكتيرية في درجات الحرارة العالية هذه، كما أنها أول مرة بالنسبة إلى العتائق الأليفة الحرارة؛ مما يكشف عن فُرَص مشوقة ويطرح أسئلة جديدة. يرى جروجان أن ميكروب «سولفولوبوس» يحتاج إلى الانتقال كآلية إصلاحية في حالة تعرُّضِ حمضه النووي لضرر ناتج عن الحرارة. وبالمثل، ربما تأقلمت الميكروبات البدائية في بداية الحياة مع العيوب الوراثية التي يسبِّبها الإشعاعُ فوق البنفسجي، الذي كان وقتذاك أقوى مما هو عليه اليوم. ومنذ ذلك الوقت، يُعتقَد أن التغيُّرات التي طرأت على العتائق أقلُّ من أيِّ نوعٍ آخَر من الكائنات الحية، وبالتالي ربما تكون عاداتها في المعيشة والحب نافذةً إلى الماضي.
(????)
أحدث التطورات

ظلَّ الجنس الميكروبي يثير مخاوِفَنا خلال السنوات القليلة الماضية. ولا نقصد بذلك هذا النوعَ الذي تخضع له أليفات الحرارة، وإنما ذلك الذي يحدث في المستشفيات حيث تتوافر المضادات الحيوية وتستبدِل الميكروباتُ جيناتِها بأخرى أشدَّ مناعةً لكي تعيش؛ مما يؤدِّي إلى ظهور سلالات مقاوِمة للعديد من العقاقير، بما في ذلك ميكروبات العنقودية الذهبية المقاومة للميثيسيلين الشَّرِس الموجود بالمستشفيات.
قراءات إضافية

M. Gross, Life on the Edge, Plenum, 1998.

الفصل الثاني
كروموسوم الأم وكروموسوم الأب


نادرًا ما تسنح لي الفرصة لكي أستعين بالشِّعر في مقالاتي، وكثيرًا ما استشهدَتْ عائلتي بسطور جوته التي تعبِّر بدقةٍ عن هذا المقال خلال فترة نضوجي؛ لهذا استغلَلْتُ الفرصةَ لكي أكتب مقالًا علميًّا حولها.
من أبي ورثتُ بنيةَ جسمي،وكذلك طبيعتي الجادة،أما ميلي للتفاؤل وحكاية القصصفورثْتُه عن أمي الحبيبة. بهذه الطريقة، حلَّل يوهان فولفجانج فون جوته إعادةَ توزيع الصفات الوراثية بمفهومه الخاص. لقد اعتقد أنه وَرِثَ بنيته الجسدية وطبيعته الجادة من أبيه، في حين أن جانبه المتفائِل ورغبته في حكاية القصص لا بد أنه قد ورِثَهما من أمه.
جوته ليس الشخصَ الوحيد المهتمَّ بهذه المسائل، وبما أننا الآن نعرف أكثرَ عن قواعد اللعبة الوراثية، فثمة فرصة أفضل لتعقُّب الأصل الذي انحدرَتْ منه هاتان الأُذُنان الكبيرتان، مع أنه لم تزل توجد بعض التفاصيل الغريبة التي لا بد من مراجعتها.
يساهم كلٌّ من الأب والأم بثلاثة وعشرين كروموسومًا في مجموع الستة والأربعين كروموسومًا التي نملكها، واحد من كل زوج، بما في ذلك زوج الكروموسومات الجنسية المتعرج. هذا التشكيل حتمي تمامًا، وأي انحراف عن هذه القاعدة سيؤدِّي إلى اختلالات خطيرة، مثل متلازمة داون. إلا أن جانبًا مهمًّا من مسألة الحظ الوراثي هنا يكمن في مسألة أيُّ النسختين من كلِّ جينٍ ومن كل كروموسوم سينقلهما الأب والأم؛ النسخة المتوارثة من الجد أم تلك المتوارثة من الجدة. بما أن كل بويضة وكل حيوان منوي لا يحمل إلا مجموعةً واحدة مكوَّنة من ?? كروموسومًا، يصبح من الضروري اتخاذ بعض القرارات الصعبة.
من الناحية النظرية، من الممكن أن يتمَّ انتقاءُ مجموعة كروموسومية كاملة من أحد الطرفين أو الآخَر، ولكن ثمة عملية اختلاط إضافية تُعرَف باسم التبادُل الكروموسومي، تُمَكِّن كروموسومات الجد والجدة من الامتزاج معًا وتبادُلِ أجزاء كبيرة من مادتيهما الوراثية، بحيث يصبح من الصعب في نهاية المطاف أن نحدِّد أيُّهما ستستقر جيناته في الحيوان المنوي للأب أو في بويضة الأم. ولهذا السبب يكون الأشقاء جميعًا مختلفين (باستثناء التوءمين اللذين من نفس البويضة المُخصَّبة).
ولكن بعد حدوث التبادل الكروموسومي، وقيام الحيوان المنوي الفائز بتخصيب البويضة صاحبة الدور هذا الشهر، مَنْ الذي يقرِّر أن تسود نسخة صفة وراثية معينة؛ كروموسوم الأم أم كروموسوم الأب؟ في حالاتٍ معينة توسَّعَ علمُ الوراثة القديم في دراستها، تكمن الإجابة في طبيعة الجين؛ فالجينات السائدة ستفوز حتى لو كانت موروثةً من أحد الأبوين فقط، في حين تتطلَّب الصفات المتنحية نسخًا مماثلةً من كلا الأبوين لكي تُظهِر نفسها في الذرية.
ولكن في تسعينيات القرن العشرين، اكتشف الباحثون أن مسألة الحظ هذه تتخطَّى مجرد التبادل الكروموسومي والصراع بين الجينات السائدة والمتنحية؛ فقد اكتشفوا في بعض الحالات أن الجينات المتطابقة تكون لها تأثيراتٌ مختلفة بناءً على كونها قد انحدرت من الأم أو من الأب.
يرجع كلُّ هذا إلى اكتشاف مذهل قام به عظيم سوراني في معهد علم وظائف الحيوان بجامعة كامبريدج عام ????؛ فقد أراد أن يعرف لماذا لا تعيش أجِنَّة الفئران الناتجة عن بويضات غير مُخصَّبة حتى نهاية فترة الحمل. لهذا، بدأ التلاعُب بالبويضات الحديثة التخصيب، حيث لم تزل النواتان المنحدرتان من البويضة والحيوان المنوي منفصلتين ويشار إليهما بالنواة الطليعية. وحين استبدَلَ بإحدى النواتين — التي تحتوي على مجموعة كروموسومية واحدة من أحد الأبوين — بنيةً مطابِقةً من بويضة مُخصَّبة مختلفة، وجَدَ أن البويضات التي تمَّ التلاعُبُ بها لا تنمو على نحوٍ طبيعي إلا إذا ظلَّتْ محتفِظةً بنواة طليعية منحدِرة من الذكر وأخرى من الأنثى. أما تلك الأجِنَّة التي انتقلت إليها مجموعتان كروموسوميتان من الذكر أو من الأنثى، فقد ماتَتْ بعد بضعة انقسامات خلوية.
وهكذا، صار من الواضح أن عدد الكروموسومات لم يكن وحده المهم لحدوث النمو، ولا اندماج الكروموسومات الجنسية؛ إذ إن اندماج نواتين طليعيتين من الأنثى كان سيؤدِّي إلى حدوث اندماج طبيعي لكروموسومَيْ «إكس»، مثلما هو الحال بالنسبة إلى كلِّ أنثى تحمل بالطريقة الطبيعية. وإلى جانب هذه المسائل العددية، فقد اتضحت أهمية وجود مساهمة غير معلومة من كلا الأبوين، من المحتمَل أن تكون عبارة عن علامة مميزة تشير إلى منشأ الجينات أو الكروموسومات، من أجل حدوث نمو سليم. ويجب أن تكون عملية التمييز هذه قابلةً للانعكاس، بما أن كل جين من الأم يمكن أن ينتقل في نهاية الأمر إلى الحيوانات المنوية للابن، وبالعكس، يمكن أن يصبح جينٌ منحدِرٌ من الأب جينًا في بويضات الابنة تنقله ضمن الجينات المنحدرة منها عندما تصير أمًّا.
شكَّ سوراني في أن النمو الجنيني قد استخدَمَ فقط النسخةَ المنحدرة من الأب أو الأم لجينات معينة، في حين كانت النسخة الثانية تحمل العلامةَ «ممنوع الاستخدام»؛ ولهذا كانت الأجنة تموت في تجربته إذا امتلكت كروموسومات الأم فقط أو كروموسومات الأب فقط. وبالطبع، سرعان ما اكتشف الباحثون أدلةً تفصيلية على أن ما لا يقل عن ?? جينًا في الفئران وفي البشر يحمل هذه العلامات، وسُميَّت هذه الظاهرة ? «الدمغ الجيني».
ولكي يعرف الباحثون تفاصيلَ كيفية حدوث الدمغ الجيني، كان عليهم التوصُّل إلى وسائل أكثر تعقيدًا واستهدافًا. وعليه، أنتَجَ باري كيفيرن وزملاؤه في جامعة كامبريدج أجِنَّة مختلطة، حيث احتوَتْ بعض الخلايا على كروموسومات أحد الأبوين فقط، في حين احتوَتْ بقية الخلايا على مجموعة الكروموسومات الطبيعية من كلا الأبوين. يمكن أن يكتمل النمو شريطةَ أن يكون نصف الخلايا على الأقل في جنين الطور المبكر طبيعيًّا. والمثير للدهشة أن الفئران التي احتوت على عدد أكبر من كروموسومات الأم وُلِدت برءوس كبيرة وأجسام صغيرة، في حين أن تلك التي احتوت على عدد أكبر من كروموسومات الأب أظهرت أثرًا عكسيًّا.
من ناحية البيولوجيا الاجتماعية، قد يُستحَثُّ المرء على تفسير هذه الميول باعتبارها صراعًا بين كروموسومات الأبوين؛ وبالتالي تعمل جينات الأب على إنتاج مولود ضخم الحجم دون القلق حيال قدر الطاقة الذي سيستنفده ذلك من جينات الأم. أما جينات الأم، فتكون أكثر ترشيدًا لطاقة الأم وتعطي الطفل مخًّا أضخم لتعوِّضه عن ضآلة جسمه. لكن ما يُؤسَف له أن التحليلات التفصيلية لمعدل الطفرات (الذي يجب أن يكون مرتفعًا في حالة وجود صراع بين جينات الأبوين) فشلت في إثبات هذه الفرضية.
دعت الاختلافات الواضحة في حجمَي الرأس والمخ كلًّا من سوراني وكيفيرن إلى تحري الدقة في تحديد أجزاء المخ التي استقرت فيها الخلايا التي تحتوي على كروموسومات الأب فقط أو كروموسومات الأم فقط؛ وتحقيقًا لهذا الهدف، وسَمَا الخلايا الجنينيةَ التي تمَّ التلاعب بها بحيث يستطيعان بعد ذلك تحديدَ الخلايا المُتحدِّرة منها في مخ الفأر البالغ.
كانت النتيجة المفاجئة كالتالي: بغضِّ النظر عن عدد الخلايا التي حملت جينات الأم فقط، كبيرًا كان أم صغيرًا، فإن الخلايا المُتحدِّرة تسود نفسَ المناطق داخل المخ، وتحديدًا تلك التي تتحكم في الوظائف المعقدة مثل التعلُّم والذاكرة، وعلى العكس من ذلك، تُستبعَد هذه الخلايا من مناطق أخرى معينة مرتبطة بالغرائز مثل التغذية والرغبة الجنسية. أجل، ما خمَّنْتَه صحيح، تسير الخلايا التي تحتوي على جينات الأب فقط في الاتجاه المعاكس تمامًا، وكأنَّ لسان حال جينات الأب المدموغة يقول: «لا أريد أن أتعلَّم شيئًا أو أتذكَّره. شكرًا، سأكتفي بالخمور والفتيات.»
لكن دعونا نتذكَّر أننا ما زلنا نتحدث عن الفئران هنا، فهل يمكن أن تنطبق هذه المعلومات على الإنسان؟ هل يمكنها أن تثبت أن جوته قد ورِثَ من أمه استمتاعَه بحكاية القصص؟ في واقع الأمر، لا بد أن كيفيرن كان يهدف إلى الإجابة عن هذه الأسئلة؛ لأن المجال الرئيسي لأبحاثه هو المهارات المعرفية لدى الرئيسيات، وهو يشير إلى تلك المناطق في المخ التي يبدو أنها ترتبط بجينات النمو المنحدرة من الأم وتنفِّذ مهامَّ معرفيةً معقَّدَة بصفتها «المنطقة التنفيذية»، موضِّحًا أن هذا الجزء هو الذي كان ينمو أكثر من غيره خلال مسار التطور البيولوجي للإنسان المعاصر. وهو يقارن هذه المنطقة ? «المنطقة العاطفية» المرتبطة بجينات الأب، والمسئولة عن التصرفات الغريزية والتصرفات المُستحَثة بالهرمونات، والتي تضاءَلَتْ بعضَ الشيء خلال تطوُّرِنا البيولوجي.
إذا استعنَّا بهذا النمط من أنماط تقسيم المخ النابع من علم الوراثة التنموي في دراسة السلوك الاجتماعي لسلالاتٍ مختلفة من الرئيسيات، فسنجد بعضَ الروابط المثيرة للفضول. على سبيل المثال، كلما كان حجم المجموعات التي تشكِّلها الرئيسيات كبيرًا، تضاءَلَ حجمُ المنطقة العاطفية؛ وبالتالي تصبح كثرة الغرائز فيما يبدو ضارة باستقرار الأوضاع. وبالعكس، يزيد حجم المنطقة التنفيذية بازدياد حجم المجموعة، فتبدو هي المسيطرة بدلًا من المنطقة العاطفية التي تتراجع سيطرتها.
بالمثل، يبدو أن حياتنا العاطفية قد انتقلَتْ جزئيًّا من مجال الهرمونات إلى مجال الأحاسيس الأكثر وعيًا؛ فيزيد حجمُ المنطقة التنفيذية كلما طالَ موسم التزاوُج. فعلى عكس معظم الثدييات، بوسعنا أن نمارس الجنس طوال السنة، ولكننا نستطيع أيضًا أن نقرِّر عدم ممارسته.
أشارَتْ بعضُ التقارير الصحفية في مبادَرةٍ سريعة من جانبها إلى أن الآباء يخسرون بسببِ الدمغ الجيني، إلا أنه لا يزال من غير الواضح معرفة إن كان للدمغ الجيني فعلًا دورٌ في نقل قدرات عقلية معينة من جيل إلى آخَر أم لا؛ فمهارات إدراكية بشرية عادية مثل اللغة والتخطيط والإبداع تعتمد على شبكة معقدة من الجينات، بعضها فقط يحمل إشارات الدمغ الجيني.
علاوة على ذلك، أثارت الأبحاث التي أُجريت على الأفراد المصابين بانحرافات كروموسومية، مثل متلازمة تيرنر (حيث يكون كروموسومُ «إكس» واحدٌ فقط هو الكروموسوم الجنسي الوحيد الموجود، وقد يتم توارُثه من الأب أو الأم)، الكثيرَ من الشكوك حول مثل هذه الاستنتاجات الفورية؛ نظرًا لأن المرضى المصابين بمتلازمة تيرنر ويحملون الكروموسوم «إكس» من الأب يجيدون المهاراتِ الاجتماعيةَ والإدراكية مقارَنةً بأولئك الذين يحملون هذا الكروموسوم من الأم. وبالتالي، فلا بد من العثور على طرق تحليلية أكثر تعقيدًا وتفصيلًا (ناهيك عن أن تكون أقل ضررًا!) كي يستطيع العلماءُ أن يكتشفوا أصلَ مهارات الحكاية القصصية تلك ومنبعها.
(????)
أحدث التطورات

حتى عام ????، لم يكن من الواضح أيُّ الجينات الموجودة في الجينوم البشري يتمُّ دمغها جينيًّا. لكن قدَّمَتْ دراسة منشورة في شهر مارس ???? قائمةً قصيرةً تحتوي على ??? جين مرشَّح، سيتعيَّن على الباحثين اختبار كلِّ جين منها على حدة.
قراءات إضافية

W. Reik and J. Walter, Nat. Rev. Genet., 2001, 2, 21.

الفصل الثالث
تجمعات الذهب اللامعة البرَّاقة


على مدار التاريخ، وحتى اليوم، يمكن تعزيز الجاذبية الجنسية ببعض من بريق المال. الأشياء اللامعة مثل الذهب والماس غالبًا ما تُعتبَر عظامًا خاملة عندما يتعلَّق الأمر بالكيمياء، ولكن ربما تتطلَّب هذه المسألة نظرةً عن كثب. فعلى الرغم من كل شيء، يمكن أن يكون عنصرَا الفضة والبلاتين مفيدين للغاية في التصوير والمحوِّلات التحفيزية، على الترتيب؛ لذا، دعونا نرَ إن كان الذهب يستطيع أن يضيف قيمةً إلى الكيمياء.
على الرغم من أنه معروف عن الذهب أنه أنبل الفلزات كلِّها، فإنه يستطيع في الواقع تكوينَ مركبات كيميائية. على سبيل المثال، إذا قام علماء الكيمياء بتسخين مسحوق الذهب جيدًا بغاز الكلور، فسيحصلون على ملح (كلوريد الذهب)، وهو الذي يستطيعون إذابته في الماء وبلْورته وتحويله إلى العديد من مركبات الذهب الأخرى بمستويات أكسدة مختلفة. وبالتالي، كان من الممكن النظر إليه بمفهوم خاطئ باعتباره عنصرًا كيميائيًّا عاديًّا، لولا ارتباطه التاريخي بالثروة والنفوذ؛ مما أدَّى إلى هوس الخيميائيين القدماء بمحاولات «تصنيع» الذهب، وهو هوس كان من ناحيةٍ دافِعًا للتطوُّر الذي أدَّى في نهاية المطاف إلى علم الكيمياء، ولكنه من ناحية أخرى أرهَقَه بميراث مشبوه.
في الوقت الحاضر، حيث لم يَعُدِ الذهبُ يبني إمبراطوريات أو يهدمها، وتضاءَلَ نفوذه مقارَنةً بأهمية موارد أخرى مثل النفط واليورانيوم، يستطيع علماء الكيمياء أن يعودوا إلى كيمياء هذا المعدن المشوقة دون اتهامهم بممارسة الخيمياء القديمة. ومع ذلك، لا يوجد باحثون كُثُر يدرسون مركبات الذهب، إلا أن ما يكتشفونه عادةً ما يكون مذهلًا ومشوقًا.
من المفترض أن يكون النحاس والفضة والذهب عناصر متشابهة؛ لأنها توجد في نفس العمود بالجدول الدوري، إلا أن الذهب باعتباره أثقل عنصر في المجموعة، وتركيبه الإلكتروني معقَّد للغاية، يظل دخيلًا بعض الشيء. ومن الأمثلة التي أثبتَتْ أهميتها على وجه الخصوص أيون الذهب الأحادي التكافؤ (Au+ بلغة الكيميائيين) الذي يُعتبَر مماثِلًا للفضة في المركبات البسيطة، مثل نترات الفضة أو بروميد الفضة، ولكنه يتصرَّف على نحوٍ مختلِفٍ تمامًا؛ فهو على سبيل المثال لا يكون مستقرًّا في المحاليل عندما يكون بمفرده، ولكن يمكن أن يستقرَّ في وجود جزيئات عضوية صغيرة (اللجينات) التي تستطيع حمايته. وغالبًا ما تحتوي مركبات الذهب الناتجة على العديدِ من أيونات Au+ المترابطة معًا بروابط ضعيفة. بعض هذه المركبات، بما في ذلك مركبات فوسفين الذهب، يمكن أن تلمع عند تحفيزها بالضوء فوق البنفسجي. (بمعنى أنها تُرسِل ضوءًا ذا طول موجي أكبر من الضوء الذي تستقبله؛ مما يمكِّنها من «تحويل» الضوء فوق البنفسجي غير المرئي إلى ضوء مرئي. تعمل مبيِّضات الأقمشة بنفس الطريقة.) وقد أثبتَتِ الدراساتُ المكثَّفة لهذه الظواهر خلال ثمانينيات القرن العشرين أن معظم مركبات الذهب لا تلمع إلا في الحالة البلورية. وفي حالاتٍ نادرة، لم تُكتشَف إلا في تسعينيات القرن العشرين، يمكن أن تلمع محاليل هذا المركب أيضًا. كما توجد طريقة ثالثة لم يُعلَن عنها إلا في عام ????، عندما حاولت إيلَّا فانج، بالتعاون مع ألين بالك بجامعة كاليفورنيا في مدينة ديفيز، استخدام الكلوروفورم لغسل بلورات مركب الذهب الذي كانت قد أعَدَّتْه، فبدأت تلمع، مع أن البلورات الجافة ومحلول المادة لم يلمعَا.
شكل ?-?: تأخذ تجمُّعات الذهب شكلَ منشور مثلثي، مثل قطع شيكولاتة توبليرون المثلثية.
على الرغم من أن تلك البلورات لم يتمَّ إكسابها صفةَ اللمعان عمدًا بواسطة الضوء فوق البنفسجي، فإنه سرعان ما توصَّلَ الباحثان إلى فرضيةِ أن التعرُّضَ غير المقصود (على سبيل المثال، من ضوء الغرفة) يمكن أن يحفِّز هذا التأثيرَ. وأثبتَتْ دراسات منهجية باستخدام مصباح للإضاءة فوق البنفسجية أن الضوءَ فوق البنفسجي يستطيع أن يجعل البلوراتِ في حالة إثارة، تظلُّ مستقرةً طوال ساعات، ولا تبدأ في تحرير الطاقة في صورة ضوء أصفر إلا عندما تذوب البلورات جزئيًّا على الأقل. ومع أن اللمعان يزول سريعًا، فإنه يمكن إعادة تنشيطه بتكرار تعريضه للضوء فوق البنفسجي. وإذا بخَّرْنا المادةَ المذيبة المستخدَمة في غسل البلورات وعرَّضْنا المادةَ الجافة للضوء، فستلمع بمجرد تعرُّضها للكلوروفورم أيضًا. تستطيع موادُّ مذيبةٌ أخرى تحفيزَ هذا الأثر، ولكن قوتها تتزايد كلما زادَتْ قابلية مركب الذهب للذوبان في المادة المذيبة. أدَّتْ هذه الاكتشافات — بالإضافة إلى المشاهَدة التي تفيد بأنْ ليس بمقدور التفاعلات الكيميائية ولا الضغط الميكانيكي إضفاءُ صفةِ اللمعان على المركب — إلى استنتاج أن عملية إذابة المادة البلورية ضروريةٌ.
ومع هذا، لا يزال من غير المعلوم شكلُ الحالة المثارة وكيفيةُ نشأة ظاهرة اللمعان. لكن كشفت الأبحاثُ البنيوية التي أجراها فريقُ بالك عن وجود تجمُّع من مركبات الذهب الحلقية الشكل، بينما يظل مثلث ذرات الذهب في نفس الاتجاه دائمًا. وبما أن هذه الشبكة البلورية — بمسافاتها القصيرة على نحوٍ غير عاديٍّ بين مراكز المعدن — فريدةٌ مثل اللمعان المحفَّز بالمادة المذيبة، يتساءَل الباحثون إن كانت الأولى هي سبب حدوث الثاني أم لا. ربما تكون الأعمدة الطويلة التي يتكوَّن لُبُّها من مثلثات نانوية الحجم من الذهب الخالص هي مفتاح فهم هذه الظاهرة. طبقًا لإحدى الفرضيات، قد يحفِّز الضوءُ فوق البنفسجي انفصالَ الشحنات؛ مما يؤدِّي إلى هجرة الإلكترونات بطول المثلثات، التي قد تشبه سلك ذهب نانوي الحجم. وقد تَعْلَق الإلكترونات بعد ذلك في انحرافات موجودة بالبلورة، حيث تخزن الطاقة المتوافقة مع انفصال الشحنات حتى تتحرَّرَ بسبب ذوبان البلورة. وتؤدِّي إعادةُ جمع الإلكترونات ومراكز المعدن الموجبة الشحنة إلى حدوث ظاهرة اللمعان.
حتى الآن، يُعتبَر هذا مجرد تخمين، وينطبق الأمر نفسه على التطبيقات المحتمَلة التي نُوقِشت في المطبوعات العلمية، بما في ذلك مستشعرات أبخرة المذيبات وتخزين الطاقة والمحوِّلات الكيميائية الضوئية. لن تصير هذه الأحلام حقيقةً إلا بعد فهْمِ هذه الظاهرة وتوجيهها نحو مساراتٍ تكنولوجيةٍ محدَّدة، وهذا بالطبع إذا لم تظهر موادُّ أخرى تستطيع أداءَ نفس الوظيفة بتكلفة أقل. مع ذلك، أثارَتْ هذه الاكتشافات أسئلةً مشوقة، وأوضحَتْ أن العناصر النبيلة لا يُشترَط فيها أن تكون مملة.
(????)
أحدث التطورات

لا أعلم شيئًا جديدًا عن تجمُّعات الذهب اللامعة، ولكن ظهرت تطوُّرات أخرى مثيرة في كيمياء هذا العنصر النفيس. ففي عام ????، أعلَنَ ستيفن هاشمي من جامعة هايدلبِرج عن اكتشاف محفِّزات الذهب، وفي عام ???? وصَفَ إف دي توست وزملاؤه طريقةً ذكيةً تستطيع بها محفِّزاتُ الذهب التمييزَ بين النسختين اليمنى واليسرى لركائزها، وهذا النوع من التمييز — المعروف باسم التحفيز العديم التناظر — هو أحد الاهتمامات الرئيسية لأبحاث التحفيز المعاصرة، بما أن عدمَ التناظُر مهمٌّ بالنسبة إلى الخلية مثلما هو مهمٌّ أيضًا بالنسبة إلى تطوير العقاقير.
قراءات إضافية

M. Gross, Travels to the Nanoworld, Perseus, 1999.

الفصل الرابع
الشُّعلة الخضراء


يمكن للأضواء أن تكون مثيرة، ومن الواضح أنه لولا ذلك لَمَا كانت هناك مناطق لممارسة الدعارة بأضواء حمراء، ولا عشاء على ضوء الشموع. لكن بالنسبة إلى علماء البيولوجيا الجزيئية، فالشمعة الجزيئية التي تتوهَّج باللون الأخضر الفاتح هي أحد أكثر الاكتشافات إثارةً خلال العقدين الأخيرين، وقد أدَّت أيضًا إلى اكتشاف بعض التقنيات الجديدة الرائعة (انظر مقال «بروتينات إشارة المرور الجزيئية»).
التوهُّج البيولوجي — أيْ تحويل الطاقة الأيضية إلى ضوء — ظاهرة جذَّابة وشائعة أكثر مما كنتَ تعتقد. المثير للدهشة أن التطور البيولوجي أعاد اختراعَ التوهُّج البيولوجي أكثر من ?? مرة منفصلة. وفضلًا عن الحُبَاحِب واليراعات المضيئة المعروفة، توجد مجموعة كبيرة من الأسماك وقناديل البحر والبكتيريا، ومن فطر عيش الغراب أيضًا، يمكنها أن تتوهَّج في الظلام. ومع أن غالبية الدراسات الرئيسية التي أُجرِيت عن التوهُّج البيولوجي كانت تعتمد على أعضاء الضوء في الحشرات، فإن التوهُّج الأخضر الذي غالبًا ما ستراه في المعامل البيولوجية هذه الأيام ينبع من الأجهزة الجزيئية لقنديل البحر البلوري المعروف باسم «أكوريا فيكتوريا».
لماذا أصبح الجهاز المشع لهذه الكائنات الهلامية مفيدًا للغاية؟ للأمر علاقة بحقيقة أن قنديل البحر يمر بخطوتين منفصلتين بدايةً من استيعاب المحفِّز الكيميائي وصولًا إلى إنتاج الضوء الأخضر. في الخطوة الأولى، يستجيب بروتينٌ اسمه الأكورين إلى إشارةٍ (تحملها أيونات الكالسيوم) عن طريق إصدار الضوء. وبما أن المرء بإمكانه التحقُّق من اللون بتعريض البروتين المنقَّى لأيونات الكالسيوم في أنبوب الاختبار، فإننا نجد أن هذا الضوء ليس أخضر، وإنما أزرق. لكن في قنديل البحر لن ترى أبدًا الضوء الأزرق؛ لأنه سرعان ما يُمتَص فورًا بفعل بروتينٍ ثانٍ، يحوِّل الطاقة إلى الضوء الأخضر. هذا الجزيء الثاني أصبح معروفًا عالميًّا ببروتين الفلورسنت الأخضر، المعروف اختصارًا ببروتين «جي إف بي» GFP، وهو لا يحتاج إلى أي جزيئات أخرى ليشع وهجه الأخضر المميَّز؛ إذ يحفِّزه فقط الضوء الأزرق أو فوق البنفسجي، حتى لو نتج بفعل الهندسة الوراثية ولم يقترب قطُّ من قنديل البحر. شكل ?-?: بنية بروتين الفلورسنت الأخضر، مثلما يُظهِرها التصوير البلوري بالأشعة السينية. تمثِّل الأسهم صفائحَ بيتا المطوية التي تكوِّن البنية الخارجية البرميلية الشكل للبروتين، وتنتمي الذرات المرسومة على هيئة كرات داخل البرميل إلى البنية المسئولة عن تفاعل الضوء، أَلَا وهي حامل الضوء.
تؤدِّي هذه الخاصية المميزة التي يتسم بها بروتين الفلورسنت الأخضر إلى تطبيق علمي مهم، اقترحه لأول مرة مارتين تشالفي وزملاؤه من جامعة كولومبيا عام ????، وأصبح إجراءً معمليًّا شائعًا خلال بضعة أشهر. غالبًا ما يريد الباحثون نقل جين من كائن حي إلى آخَر؛ كي يبدأ الثاني في إنتاج البروتين الذي يشفِّر له هذا الجين، وسيكون من المفيد أن توجد طريقة بسيطة للتأكُّد من حدوث هذا الانتقال. عن طريق دمج الجين المُنتِج لبروتين الفلورسنت الأخضر مع الجين محل الاهتمام، في أثناء محاولة الانتقال الجيني، ووضع الخلايا المنقولة تحت مصباح الأشعة فوق البنفسجية (المتاح في كلِّ معملٍ من معامل البيولوجيا الجزيئية)؛ يمكن التحقق فورًا من الأمر. فإذا أصدرَتِ الخلايا ضوءًا أخضر، فقد تمَّ النقل بنجاح، هذا هو الأمر بكل بساطة. كانت هناك تحليلات مشِعَّة أخرى من قبلُ، ولكنها كانت جميعًا تتطلَّب موادَّ كيميائية إضافية، يجب نقلها إلى الخلية عبر غشائها الخلوي. وإذا رفضَتِ الخلايا الركيزةَ المطلوبة لأي سبب، فسيؤدي هذا إلى نتيجة سلبية زائفة.
بالتالي، اعتُبِر بروتين الفلورسنت الأخضر مؤشرًا جينيًّا ذا إمكانيات فريدة، وخلال عام من ظهور أول بحث عن تطبيقاته العلمية، كان الجين المُنتِج له متاحًا تجاريًّا بصفته إحدى أدوات البيولوجيا الجزيئية. كما استمتع علماء الفيزياء الحيوية أيضًا باستخدام هذا البروتين، وحاولوا أيضًا زيادة فائدته بجعله يلمع بألوان مختلفة، بل وأمكنهم حتى أن يجعلوه يومض بأسلوب إيقاعي، مثلما سنرى فيما يلي.
واجهت الأبحاثُ الرئيسية التي أُجرِيت عن بنية بروتين الفلورسنت الأخضر وآليته صعوبةً في مواكبة سرعة التقدُّم في مجال البيولوجيا الجزيئية. فلم يُكشَف عن البنية الجزيئية لهذا البروتين إلا في عام ????، وقد وُجِد أنها تتمتع بتركيب بروتيني جديد وغريب؛ فالغلاف الخارجي للبروتين عبارة عن برميل متناسق تمامًا وضخم للغاية مكوَّن من ?? جديلة من صفائح بيتا المطوية، وأطراف البرميل مغطَّاة بأغطية مكوَّنة من مقاطع لولبية قصيرة، وداخل تجويف البرميل يوجد لولب أطول كثيرًا يتوافق محوره مع محور البرميل، وفي وسط هذا اللولب، الذي يشبه الخيط في وسط مصباح الضوء، نجد الجزء المشع من الجزيء؛ حامل الضوء، وهو يتكون نتيجة تفاعل كيميائي غير عادي يتم بين بقايا الحمض الأميني المجاورة داخل السلسلة البروتينية، عندما يتعرَّض البروتين للطي لأول مرة.
وتُعتبَر معرفة البنية الثلاثية الأبعاد لهذا البروتين ذات أهمية خاصة؛ لأنه يُعتقَد أنها تحفِّز نفس العملية غير العادية التي يتكوَّن بفضلها حاملُ الضوء. وبما أن تكوين حامل الضوء قد تمَّ بسلاسةٍ في كل كائن حي مضيف خضَعَ للتجربة من قبلُ، فقد شكَّ الباحثون في أن التفاعل ذاتيُّ التحفيز؛ أي إنه تفاعُلٌ يحفِّزه نفس الجزيء بدلًا من إنزيم آخَر غير معروف حتى الآن.
ومع هذا، لم يظهر دليل يؤكِّد صحة هذه الفرضية إلا في عام ???? على يد براين ريد وجريج فلين من جامعة أوريجون؛ فقد أنتَجَا البروتين في صورة سلاسل متعددة الببتيدات غير مطوية بعدُ ومرتبطة بما يُطلَق عليه اسم الأجسام المشتملة في «الإشريكية القولونية». بعد تنقية الأجسام المشتملة، استطاعوا ملاحظة جزيئات بروتين الفلورسنت الأخضر التي لم تتعرض للطي قطُّ، ناهيك عن التنشيط، وهي تُطوَى وتُنفِّذ التعديلات الكيميائية التي تؤدِّي إلى تكوين حامل الضوء، وهي عملية تستمر عدة ساعات.
تتيح لنا هذه البنية المعروفة أيضًا فهْمَ أو التنبؤ بالكيفية التي تؤثِّر بها الطفرات — أيْ تبادُل أحماض أمينية بعينها في التسلسل النووي — على توهُّج البروتين. ومع أن الضوء الأخضر الناتج يكون بالضرورة أحادي اللون (أي إن جميع الفوتونات لها تقريبًا نفس الطول الموجي)، فإن امتصاص الطاقة يمكن أن يحدث في نطاقين مختلفين للطَّيْف. يجيد البروتين الطبيعي المأخوذ من قنديل البحر امتصاصَ الضوء بدايةً من البنفسجي وصولًا إلى فوق البنفسجي (حوالي ??? نانومترًا)، ولكنه يستطيع أيضًا استخدام الضوء الأخضر المائل إلى الزُّرقة بأطوال موجية تبلغ حوالي ??? نانومترًا. توصَّلَ الباحثون إلى أن النطاق الأول يتضمَّن الحالةَ المحايدة كهربائيًّا لحامل الضوء، في حين أن النطاق الثاني يتطلَّب شحنةً سالبة في هذا الجزء من الجزيء. وعن طريق إحداث تغييرات معقَّدة في تلك المناطق من البروتين المعروفة بقربها إلى حامل الضوء، يستطيع الباحثون التأثيرَ على حالة شحنته، وبالتالي إنتاج صور من بروتين الفلورسنت الأخضر بخواصَّ بصرية شديدة التخصيص. على سبيل المثال، تقتضي الدواعي العملية امتصاصًا قويًّا بطول موجي يبلغ ??? نانومترًا؛ نظرًا لوجود أشعة ليزر تتميَّز بهذا الطول الموجي تحديدًا، ويمكن استخدامها لإنارة جزيئات البروتين بدقة متناهية من حيث الزمان والمكان معًا.
أدَّت اثنتان من هذه الصور أيضًا إلى اكتشاف الومضات في بروتين الفلورسنت الأخضر، وذلك في عام ???? على يد فريقٍ بقيادة دبليو إي مورنر من جامعة كاليفورنيا في سان دييجو. فلكي يراقِب العلماء جزيئاتٍ بعينها من بروتين الفلورسنت الأخضر على نحو مستقل، وضعوا جزيئات البروتين في هُلام مسامي، لكي تعجز عن الحركة بينما يظل بإمكان كلٍّ من الضوء والمواد الكيميائية الوصول إليها، وعرَّضوا الجزيئات الحبيسة لضوءٍ ذي طول موجي مناسب، وصوَّروا التوهُّج بواسطة ميكروسكوب. يمكن تسجيل الانبعاث الضوئي لجزيئات بعينها على نحو منفصل، شريطةَ أن تكون الجزيئات منفصلةً بمسافة أطول من درجة وضوح الميكروسكوب.
بهذه الطريقة، استطاع مورنر وزملاؤه التوصُّل إلى أن كلَّ جزيء يتلألأ لبضع ثوانٍ، ثم يخمد لبضع ثوانٍ، ثم يبدأ في السطوع مرة ثانية. دام هذا «الوميض» لدقيقتين، وانتهى عندما انبعث من الجزيئات حوالي مليون فوتون، وعندئذٍ «انسحبت» وبقيت غير نَشِطة على نحو دائم. ومع هذا، فحتى هذه الحالة «الانسحابية» يمكن إعادة تنشيطها بتعريضها لضوء ذي طول موجي أقصر (طاقة أعلى) من ذلك المُستخدَم في التجربة الأصلية.
من الواضح أن البروتين يمكن أن يظهر في ثلاث حالات: الحالة النَّشِطة، والحالة الدائمة الظلام، والحالة المتقطعة الظلام. ومع أن علماء الفيزياء واثقون في أنهم يستطيعون تفسير الحالتين الأوليين، فإن الحالة المظلمة بين النبضات الضوئية هي ما حيَّرتهم. لا تزال النظريات الحالية افتراضية بعض الشيء، ولن أخوض في مزيد من التفاصيل بشأنها.
بصرف النظر عن التحدي الفكري والإبداعي، تتمتع هذه التجربة أيضًا بأهمية عملية؛ فقد يكون هذا أولَّ نظام بصري جزيئي يمكن تشغيله في درجة حرارة الغرفة بين حالتين مختلفتين يمكن استخراجهما من جزيئات بعينها. وبالتالي، فالجزيء الذي يستجيب لضوء قصير بالوميض، سيشفِّر للرقم ?، في حين أن الجزيء الذي يمر بالحالة المظلمة سيشفِّر للرقم صفر في النظام الثنائي. ومع أن تشغيلًا مماثلًا يمكن أن يتم في بروتين رودوبسين الجرثومي، فإنه في هذه الحالة سيتطلب استخراج المعلومات المخزنة في الجزيئات قياسًا للامتصاص، ونظرًا للميزة التي يتمتَّع بها بروتين الفلورسنت الأخضر من حيث تلألؤه وسهولة رصده على مستوى الجزيء الواحد، فمن المحتمَل ظهور تطبيقات في العديد من المجالات للأجهزة الإلكترونية البصرية في المستقبل، وصولًا إلى الكمبيوتر المعتمِد على البروتين المراوغ.
لكن إذا عدنا إلى واقع الوقت الحاضر، فسنجد أن تطبيقات بروتين الفلورسنت الأخضر وصوره المتنوعة قد أصبحت إجراءً شائعًا في العديد من المعامل. كما أن الميكروبات الوحيدة الخلية ليست هي الوحيدة التي تلمع في الظلام لتكشف عن وجود جين منقول؛ ففي بعض الأماكن سيصدر ضوء عن نباتات وحيوانات بأكملها، وفي أماكن أخرى سيصدر ضوء عن أجزاء معينة منها، مثل الأورام الخبيثة. دمج كارل جيه أوباركا وزملاؤه بمعهد أبحاث المحاصيل الاسكتلندي في دَندي فيروساتِ النباتات بواسِم بروتين الفلورسنت الأخضر لكي يدرسوا كيفية انتشار الفيروس عبر النباتات المصابة، والعوامل التي قد تؤثِّر في نموه. كما استخدَمَ علماءُ وظائف النبات في اليابان بروتينَ الفلورسنت الأخضر كي يدرسوا تفاعُلَ الصدمة الحرارية في نبات الأرز.
يلمع بروتين الفلورسنت الأخضر في الحيوانات بنفس درجة لمعانه في النباتات، وقد احتوت دراسات رائدة على التعبير الجيني لهذا البروتين في ذبابة الفاكهة (????) وفي السمك المخطط (????). وباستخدام نوع من بروتين الفلورسنت الأخضر ذي كثافة لمعان متزايدة، استطاع ماسارو أوكابي وزملاؤه من جامعة أوساكا باليابان لأول مرة استيلادَ فئران تلمع تمامًا باللون الأخضر تحت مصباحٍ للأشعة فوق البنفسجية. نقل الباحثون الجين إلى البويضات المُخصَّبة، فاستطاع بالفعل الانتقالَ إلى جميع خلايا الجسم البالغة؛ وعلاوة على ذلك، انتقل الجين أيضًا إلى جيل جديد من الفئران اللامعة باللون الأخضر.
لا تهدف مثل هذه الدراسات بالطبع إلى تناوُلِ المشكلات التي قد تقابلها عندما تعجز عن تحديد مكان فأر التجارب في الظلام، بل إنها تَعِد، بصفة أساسية، بتقديم أفكار جديدة لتحسين الأجِنَّة الثديية، إلى جانب أدواتٍ تشخيصية جديدة في التطبيقات الطبية. يمكن استخدام بروتين الفلورسنت الأخضر لتعقُّب انتشار النمو الثانوي للأورام السرطانية. بصفة عامة، كلما لُوحِظت خلايا من أصل مختلف معًا، يقدِّم الوَسْم بالفلورسنت وسيلةً سهلة لتمييزها، كما أن طُرُقَ العلاج الجيني في المستقبل ستستفيد بالتأكيد من خيار التحكم في الجين العلاجي واستهدافه باستخدام واسِم بروتين الفلورسنت الأخضر. وفي تجربة رائدة، ربما يمكن تقديمُ هذا البروتين إلى مستنبت خلوي مشتقٍّ من خلايا الميلانوما في الإنسان، والحفاظُ على استقراره فيها.
سيُصمَّم المزيد والمزيد من الأدوات بواسطة بروتين الفلورسنت الأخضر، ومن أجله. في أحد الأمثلة الحديثة، جمع أتسوشي مياواكي وزملاؤه من جامعة كاليفورنيا في سان دييجو صورتين ملوَّنتين مختلفتين من هذا البروتين في بنية واحدة، فأحاطا وحدة ارتباطية من الكالسيوم مصنوعة من بروتين كالمودولين والببتيد «إم ??» M13. بمجرد ارتباط الكالمودولين بأيون الكالسيوم، تتغيَّر هندسة البنية بحيث تستطيع الصورة التي تمتصُّ وتشع بأطوال موجية أقصر تمريرَ الطاقة إلى شطر بروتين الفلورسنت الأخضر الثاني، الذي سيشع عندئذٍ الضوءَ بطول موجي مميَّز. وبناءً على كفاءة الارتباط التي تتسم بها صورة الكالمودولين المستخدمة، تستطيع هذه الوسيلة قياسَ تركيزات الكالسيوم المتراوحة ما بين جزءٍ من المائة وجزء من ?? مليارات من المول للِّتر الواحد، بدرجة وضوح فراغية تتيح للباحثين مقارنةَ التركيزات بين الأقسام المختلفة لخلية واحدة. الفيزياء الحيوية، والطب، وعلم الأحياء التنموي، وعلم الأحياء الجزيئي … فيما يبدو لا يوجد جانب في مجال علوم الحياة الواسع لم تُضِئْه الشعلةُ الخضراء بعدُ. يعمل بروتين الفلورسنت الأخضر كركيزة نموذجية، ومِسبارٍ لقياس المؤشرات الفيزيائية الحيوية داخل الخلية، ومتعقِّبٍ فلورسنتيٍّ لمتابعة مسارات النقل في الخلايا أو الكائنات الحية. ومع أن ثمة جزيئات أخرى قد حظيَتْ مثله بأهمية رائعة، فإن أحدها لم يطل كثيرًا من الجوانب المختلفة أو ظهرت له تطبيقات عملية في العديد من المجالات. يبدو أن الضوء الأخضر متفوِّق في هذه المسألة واحتمالات تطبيقه لا تزال واسعة.
(????)
أحدث التطورات

بدايةً من عام ????، لمع بروتين الفلورسنت الأخضر والعديد من المنتجات المشتقة منه بألوان عديدة في أماكن كثيرة حول العالم. وقد أظهرت عملية بحثٍ سريعةٍ على موقع جوجل ??? مليون نتيجة بحث عنه. وثمة قليلون مرشَّحون بقوةٍ لنيل جوائز نوبل في المستقبل في هذا السياق.
قراءات إضافية

M. Gross, Light and Life, Oxford University Press, 2003.

الفصل الخامس
اقرأ شفتيَّ!


يصلني جميع أنواع التقييمات على المقالات التي أنشرها، ولكن وصلتني مرة واحدة في حياتي دعوةٌ لمشاهدة العرض الأول لإنتاجٍ مسرحيٍّ مستوحًى من إحداها، ثم عجزت عن الحضور، وبهذا لن أعرف أبدًا كيف تُرجم عملي على المسرح. وكان النص المشار إليه عبارة عن رأي حول تأثير ماكجورك والأفلام المُدبلجة، كما أنه كان سببًا في تغطيةٍ مثيرةٍ عندما ظهر لأول مرة في مجلة «نيو ساينتيست». وفيما يلي النسخة الأصلية الكاملة.
هذه ليست مزحة مطلقًا؛ فنحن نمارس قراءة الشفاه في المحادثات العادية دون أن نعي ذلك في العادة، وقد أثبت هذا كلٌّ من هاري ماكجورك وجون ماكدونالد من جامعة سُري في عام ????؛ فعندما عرَّضَا المستمعين المنتمين لفئات عمرية مختلفة، سواء أكان إلى صوت مُسجَّل فقط أم إلى نفس الصوت مصحوبًا بمقطع مرئي يُظهِر حركات شفاه غير متطابقة، ثم طلَبَا من المتطوعين تكرارَ ما سمعوه؛ اكتشَفَا أن ??? من الإجابات كانت خاطئة عندما كان المُدخَل البصري المتعارِض مستخدَمًا، في حين أن جميعهم تقريبًا كانت إجاباتهم صحيحةً دون استخدام هذا المُدخَل. على سبيل المثال، المتطوعون الذين سمعوا «با-با» ولكنهم رأوا حركة الشفاه تتطابق مع «جا-جا»، ذكروا أنهم سمعوا «دا-دا»؛ مما يشير إلى أن الكلام المسموع عبارة عن إشارة مدمجة تجمع بين المدخَلات السمعية والمدخَلات البصرية.
تم الاستشهاد بتأثير ماكجورك — حسبما أصبح يُطلَق على هذه الظاهرة — أكثرَ من ?? مرة في المجلات العلمية التي تتنوَّع ما بين «أدفانسيد روبوتيكس» وصولًا إلى «ساينس». تناولت الدراسات اللاحقة جميعَ أنواع الحالات الخاصة، بما في ذلك التبادُل السمعي البصري لصوتَي الرجل والمرأة («… وجوه نساء وأصوات رجال، حسب تأثير ماكجورك»)، والمقارنات ما بين الثقافات («العوامل الثقافية واللغوية في معالجة الحديث السمعي البصري: تأثير ماكجورك لدى المتطوعين الصينيين»)، والمتحدثين الواقفين على رءوسهم («فهم الحديث من وجوه مقلوبة»، وهو عنواني المفضَّل في هذه القائمة).
ومع هذا، فقد أُجرِيت تجربة واسعة النطاق حول هذا التأثير في العديد من الدول دون ملاحظتها بالفعل، وحسبما أعرف، لم يزعج أحدٌ نفسه حتى بجمع النتائج. فما زال الملايين من الأفراد يتعرَّضون لظروف تجربة ماكجورك في جميع هذه الدول حيث تُعرَض الأفلام الأجنبية عادةً بنُسَخ مُدبلجة، كما هو الحال في ألمانيا وفرنسا على سبيل المثال، ولكن ليس في هولندا ولا بريطانيا. والمثير للدهشة أن معظم المشاهدين الألمان لا يجدون غضاضةً في أن يخالف الصوت حركة الشفاه؛ مما يوحي بأن تأثير ماكجورك يمكن إبطاله، لو أن عادة مستمرة لمدة سنة أعطَتْ أمرًا للمخ بأن إشارات الشفاه في هذه الحالات عديمةُ المعنى. وعلى العكس من ذلك، عندما يجد المشاهدون الألمان أنفسهم في موقفٍ تسير فيه الدبلجة عكس ما اعتادوا عليه، مثلًا عند رؤية ممثِّل ألماني بصوت فرنسي، فإنهم يعترضون بشدة على «الصوت الخاطئ».
من واقع تجربتي الخاصة في الانتقال من دولةٍ تعتمد على الدبلجة إلى أخرى لا تدبلج (من ألمانيا إلى بريطانيا)، أعلم أن قراءة الشفاه اللاواعية التي تعطَّلَتْ بالتعود على رؤية الأفلام المُدبلجة تعود مجدَّدًا بعد قضاء بضعة أشهر فقط في دولةٍ لا تدبلج، حتى عند التعرض تعرُّضًا بسيطًا للسينما والتليفزيون. في الوقت الحاضر، تكفي رؤية مادة مدبلجة لإثارة جنوني، بغض النظر عن اللغة المُدبلج منها أو المُدبلج إليها، شريطة أنني أعرف على الأقل إحدى اللغتين. على سبيل المثال، تُعتبَر مشاهدةُ فيلمٍ سويدي (يظهر فيه ممثلون لا أعرفهم، وبالتالي لا أملك فكرة مسبَقة عن اللغة أو الصوت الذي يجب أن يستخدموه) مدبلجٍ إلى الألمانية أمرًا لا يُطاق؛ وذلك فقط بسبب عدم التطابق الشنيع في حركات الشفاه. (لا أفهم كلمةً واحدة باللغة السويدية؛ لهذا لم أنعِ فقدان اللغة الأصلية لهذه الدرجة في هذه الحالة.) ومن التجارب الصادمة الأخرى النسخةُ الألمانية من الفيلم الفرنسي «سيرانو دي بيرجراك»؛ فالقصة — حسبما تتذكرون — تدور حول شابٍّ ذي أنف طويل للغاية يفوز بحب امرأة بفضل استخدامه للُّغة الجميلة، ورجلٍ لا وزنَ له أقل منه من حيث نتوءُه الأنفي وقدرته اللغوية. تحوَّل الحوار، الآسِر حقًّا في النسخة الأصلية، إلى نثر رديء على نحوٍ لا يُحتمَل في النسخة الألمانية، وبالتالي جعل القصة كلها تبدو سخيفةً.
حتى اللغات التي أعرفها بعض الشيء، مثل الألمانية أو الهولندية، أشعر أن شيئًا يتداخل مع اللغة المُتحَدَّث بها، حتى في الوقت الذي أقرأ فيه الترجمة، ويُعتبَر الفيلم الهولندي «أنطونيا» مثالًا ممتازًا على هذا؛ فقد وجدت اللغةَ الأصلية شاعريةً للغاية، لدرجة أنني توقَّفت عن قراءة الترجمة، واعتمدتُ فقط على تشابه الهولندية بالألمانية لفهم مضمون الحوار. وبالمثل، استمتعتُ بتعلم بعض أساسيات اللغة الإيطالية من فيلم «ساعي البريد»، مع أن رؤية فيليب نويريه مُدبلجًا من الفرنسية إلى الإيطالية كانت مستفِزَّة. (بعض الأفلام الحديثة التي تتضمن مزيجًا من ستِّ دول مختلفة أشبه بخمر الاتحاد الأوروبي الرخيص؛ إذ لا يبدو في الواقع أنها تعرف شيئًا اسمه نسخة أصلية غير مُدبلَجة.)
ولكن بالنظر إلى أن معظم صناعة الدبلجة الأوروبية تتمُّ من الإنجليزية إلى الألمانية (والفرنسية والإسبانية، … إلخ)، في حين أن كلَّ مرتاد ألماني للسينما يعرِف على الأقل قدرًا من الإنجليزية أفضل من بعضِ أبطال أفلام الحركة الأعلى أجرًا في هوليوود، وبالتأكيد أكثر مما أعرف الهولندية، فإنني لا أرى منطقًا لهذه الصناعة برمتها؛ فالمستهلكون يفقدون بلا شك جزءًا من التجربة السمعية البصرية الطبيعية، والأفلام الممتازة يمكن أن تتشوَّه على نحوٍ يفوق الوصف، وحتى الأفلام الرديئة لا يمكنها أن تفوز. (يميل جمهور التليفزيون الألماني إلى المجادلة بشأن هذه النقطة بأن النسخة الألمانية من مسلسل «ستارسكي وهاتش» تثير الضحك على نحوٍ يفوق ما في النسخة الأصلية، وهو ما لم أتأكَّد منه بنفسي. وحتى لو كان هذا صحيحًا، فإنه يظل الاستثناء الذي يثبت القاعدة.)
قد تتساءل في هذه المرحلة عن ماهية الشيء الذي أتحدَّث عنه، هذا لو كنتَ تعرف جانبًا واحدًا فقط من هذا الانقسام الثقافي. لو كنتَ تعيش في دولةٍ لا تدبلج ولم تشاهِد قطُّ فيلمًا مُدبلجًا، فحاوِل الحصولَ على فيديو أطفال سويدي مثل «بيبي لونجستوكينجز»؛ فهذه الحلقات لا بد من دبلجتها في معظم الدول، كما أن الاقتراب من وجوه الأطفال وهم يتحدَّثون بصوت عالٍ بعض الشيء وبوجوه معبِّرة للغاية يتيح احتكاكًا ممتازًا بالظاهرة. وعلى العكس من ذلك، لو كنتَ تعيش في دولة تدبلج ولم تدرك قطُّ أن أصواتًا خاطئة تصدر من جهازك التليفزيوني، فاقضِ عطلتك القادمة في إحدى الدول التي تدبلج الأفلام بلغة مختلفة (ستكون فرنسا أو إسبانيا وجهةً ملائمة) وشاهِد بعض الأفلام الأمريكية العادية تُنطَق باللغة «الخاطئة». ثم اعتبر أن الأصوات غير مطابقة تمامًا مثل تلك الصادرة من جهاز التليفزيون في بيتك.
في كلتا الحالتين، ستندهش، وقد اندهشت أنا شخصيًّا. من الناحية العلمية، تتيح بالطبع تجربة ماكجورك العظيمة هذه — التي ضمَّتْ ملايين البشر كحقلِ تجارب وهم غير مُدرِكين — فرصةً فريدةً من نوعها؛ إذ يجب على علماء النفس التجريبيين دراسة كيفية تمكُّن المشاهدين من تعطيل قراءة الشفاه دون أن يعوا حتى أهميةَ ما يفوتهم. لكنْ لدواعٍ ثقافية، أريد أن أطالِب بمنع الدبلجة، أو مقاطعة النسخ المُدبلجة؛ نظرًا لغياب السلطة المناسبة لتنفيذ هذا الأمر.
(????)
أحدث التطورات

مع أن هذه المقالة كانت واحدةً من أنجح مقالاتي من حيث تأثيرها والملاحظات التي وصلَتْني عليها، فإنني لم أتابع هذا المجال أكثر من ذلك؛ لهذا لا أعرف أحدث التطورات. ولكن إذا بحثتَ في هذا المجال وتوصَّلتَ إلى شيء مثير، فكل ما عليك أن تلتفِتَ إليَّ لتخبرني، وسوف أقرأ شفتَيْكَ.
قراءات إضافية

كل ما عليك هو البحث على موقع جوجل باستخدام كلمة البحث McGurk لتجد الكثير من المعلومات الغريبة والممتعة عن قراءة الشفاه.
الفصل السادس
سِرُّ المذاق الحلو لبعض البروتينات


يمكن أن يجعل الجنسُ الحياةَ ألذ، واللذة يمكن أن تجعله أفضل، وبالتالي من الواضح أن ثمة رابطًا مهمًّا هنا يمكن اعتباره حجةً لي كي أورد هذا المقال القصير الممتع عن البروتينات الحلوة المذاق. وفوق هذا، توجد أيضًا بروتينات تغيِّر إدراكَنا وتجعل طعمَ أشياء أخرى حلوًا، وهو ما يوحي مجددًا بأن الحب أعمى. وهكذا دون مزيدٍ من الحديث المعسول، أقدِّم بعضَ التجارب الحسية المعتمِدة على التذوُّق.
استخدم سكَّان غرب أفريقيا التوتَ الأفريقي («ديوسكوريوفيليوم كومينسي») كمُسكِّر منذ قرون؛ فمذاق اللب الدبق ليس فقط قويًّا، ولكنه يدوم أيضًا لفترة طويلة.
لم يكتشف علماء العالم الغربي أمرَ هذا التوت إلا في ستينيات القرن العشرين، عندما أدت المخاوف من التأثيرات المحتملة المُحفِّزة لانتشار السرطان والناتجة عن مادة السيكلامات المُحلِّية إلى بحثٍ محموم عن بدائل. (بُرِّئت حاليًّا ساحةُ السيكلامات من هذه التهمة، ولكنها فقدت معظم حصتها السوقية السابقة لصالح مادة أسبارتام.)
في عام ????، عزل باحثون من مركز مونيل كيميكال سينسيز في فيلادلفيا المكوِّن النَّشِط من التوت الاستوائي، والمثير للدهشة أنه اتضح أنه بروتين صغير، وزنه الجزيئي ?????. وتكريمًا للمعهد الذي اكتُشِف فيه، سمَّاه الباحثون مونيلين. إذا قارنَّا المونيلين بقدر مماثل من السكر المنزلي، فسنجد أن مذاقه أكثر حلاوةً منه بثلاثة آلاف مرة، أما بالنسبة إلى أكثر المُحلِّيات المُصنَّعة فاعليةً، وهما الأسبارتام والسكرين، يصل هذا الرقم إلى ??? و??? على التوالي.
من المعروف الآن أن ثمة عائلة من البروتينات الصغيرة والرائعة في نفس الوقت لها مذاق حلو قوي للغاية. لمدة طويلة، كان أمر هذه البروتينات مثيرًا للفضول فحسب، ولكن في تسعينيات القرن العشرين أدرك الناس إمكاناتها. كان الثوماتين أولَّ بروتين من هذه البروتينات يحصل على الموافقة ليكون مادة مضافة للأغذية في أمريكا الشمالية وأوروبا.
ولكن كيف تحقِّق هذه البروتينات هذا التأثيرَ الحلو القوي على نحوٍ عجيب؟ في منتصف التسعينيات، كان الباحثون يأملون في الإجابة عن هذا السؤال عن طريق حلِّ البِنى الجزيئية لثلاثة من هذه البروتينات بالتفصيل، وهي الثوماتين والبرازين والمونيلين. لكن تحطَّمَت آمالهم عندما اكتشفوا أنه ليس ثمة تشابُه على الإطلاق في بنية البروتينات الثلاثة، والمحيِّر في الأمر أن كلًّا منها أكثر شبهًا ببروتين مختلف عن البروتينين الآخرين غير فعَّال المذاق. فالبرازين على سبيل المثال يبدو أنه مرتبط بعائلة من البروتينات تتمتَّع بنطاق واسع من الوظائف في النباتات، بدءًا من الدفاع وصولًا إلى الإنزيمات الأيضية.
توصَّلت دراسات الطفرات التي أُجرِيت على البرازين إلى موقعين يرتبطان بنشاط التذوُّق، لكن المحبِط أن الموقعين موجودان على طرفين متقابِلين من الجزيء، وبالتالي لا يمكنهما بأية حال من الأحوال التفاعُلُ في نفس الوقت مع إحدى الخلايا المستقبِلة للمذاق على اللسان.
لا تزال غير واضحةٍ الكيفيةُ التي ترتبط من خلالها بالضبط البروتيناتُ الحلوة المذاق بأجهزة الإحساس المقابلة. ويمكن أن نُرجع قدرًا من الذنب إلى حقيقة أن حاسة التذوق غير مفهومة جيدًا من الناحية الجزيئية (انظر الجزء الذي يتحدث عن الخلية المُستقبِلة للمذاق المُر، في مقال «مسألة ذوق»).
لكن يبدو أن ثمة شيئًا مؤكدًا؛ فالمذاق الحلو القوي على نحو يثير الدهشة الذي تتسم به هذه البروتينات يعكس فيما يبدو ارتباطًا قويًّا للغاية بجزيئها المستهدَف، ومما يؤكِّد هذا أيضًا ملاحظتُنا بأن الإحساس بالمذاق الحلو يستمرُّ لدقائق أو حتى لساعات. يُعتبَر السكر العادي بالمقارنة مع هذه البروتينات جزيءَ إشارةٍ ضعيفًا بعض الشيء؛ فأقل كمية نتذوَّقها من السكر هي أكبر بعدة قيم أسية مقارَنةً بالحد الأدنى من كمية الهرمونات اللازمة لبلوغ هذا التأثير.
وبالتالي، فمن المحتمَل أن السكر لا يرتبط في الواقع بأيٍّ من الخلايا المستقبِلة تحديدًا، وبدلًا من ذلك، قد يكون له تأثير أعم على عنصر الإشارة في مواقع الإدراك الحسي للمذاق، مثل القناة الأيونية.
يوجد أيضًا الارتباطُ القوي المميَّز والتأثيرُ الطويل الأمد في مجموعة ثانية من البروتينات «اللذيذة»، وتحديدًا البروتينات المُحسِّنة للمذاق؛ فبروتينات مثل الكركلين والميراكلين ليس لهما مذاق في حدِّ ذاتهما، ولكنَّ ابتلاعَ قدرٍ صغير من هذه البروتينات سيجعل الأطعمةَ المُرَّة حلوةَ المذاق لساعات.
من المُحتمَل أن تثير جميع هذه العناصر «العجيبة» اهتمام الصناعات الغذائية. ومع أن عملية استخلاصها من الفاكهة الاستوائية تتَّسِم بالتعقيد؛ مما يجعلها باهظةَ الثمن إلى حدٍّ ما، فإن هذا تعوِّضه الفاعليةُ العالية التي تتميَّز بها الجرعات المنخفضة للغاية. ولهذا السبب نفسه، يمكن أن تكون المُحلِّيات جذَّابةً كعوامل مساعدة في الحِمْيَة الغذائية؛ فقدرٌ من البروتين مساوٍ لملء ملعقة من السكر يُعتبَر صغيرًا للغاية لدرجة أن قيمةَ سعراته الحرارية أقلُّ من أن تُذكَر.
أحدث التطورات

من المثير للدهشة أنه لم تظهر أيُّ اكتشافات جديدة مهمة في هذا المجال منذ أن كتبتُ عنه في عام ????. وحتى الآن، المعروف فقط هو خمسة بروتينات حلوة المذاق وبروتينان مُحسِّنان للمذاق، وأسلوب عملها لا يزال محيِّرًا.
الخبر الأخير: في سبتمبر ????، أعلن باحثون من جامعة ناجويا سيتي باليابان عن دراسات في الطفرات لبروتين الكركلين، مصحوبة بتحليل تذوُّقٍ. تشير النتائج فيما يبدو إلى أن الأجزاء المختلفة من الجزيء تتفاعَلُ بطرق مختلفة مع الخلية المُستقبِلة للمذاق الحلو، وبالتالي تُنتِج تأثيرَي التحلية وتحسين المذاق المنفصلين.

الفصل السابع
مسألة ذوق


جزءٌ من مشكلة فهم البروتينات الحلوة المذاق التي سبقت مناقشتها، يكمن في حقيقة أن الإدراكَ الحسي للمذاق والرائحة هو موضوعٌ لا يعلم عنه العلمُ الحديث للأسف إلا نَزْرًا يسيرًا. ومنذ نهاية تسعينيات القرن العشرين فقط بدأ الباحثون فهْمَ هذا المجال والتعامُل معه، مبتدعين بعضَ المقالات المذهلة عن اكتشافاتهم طوال الوقت، والتي استعرضتُها في مناسباتٍ عدة.
هل سألتَ نفسك يومًا، في أثناء استمتاعك بوجبة لذيذة: «تُرى، كيف تعمل حاسة التذوق؟» حسنًا، ربما لم تفعل؛ إذ يميل الناس إلى أن يكونوا مهووسين إما بالعلم وإما بالطعام، ولكن نادرًا ما يهتمون بالأمرين معًا. وربما من الأفضل ألَّا تهتم بهما؛ لأن الإجابة ستكون أنه حتى العلماء الذين يدرسون هذه الحاسة لا يعلمون الكثيرَ عنها حقًّا. والتذوق، من بين حواسنا الخمس كلها، هو الحاسة التي نفهمها أقلَّ من غيرها، بَيْدَ أن كمَّ المعلومات الوراثية التي تتدفَّق إلينا بفضل مشروع الجينوم البشري، قد ساعَدَ العلماء الآن في أن يبدءوا على الأقل في سدِّ هذه الفجوة المعرفية المُزعجة.
توجد خمسة مذاقات أساسية تستطيع براعمُ التذوُّق الموجودة في اللسان وحلق الفم تمييزَها، وهي: المالح، والحامض، والحلو، والمُر، واللذيذ (طعم الجلوتامات الموجود في اللحوم وصلصة الصويا). من المنطقي بالنظر إلى حالة معرفتنا ألا يُكتشَف المذاق الأخير إلا في عام ????؛ فمفهوما المالح والحامض يسهل شرحهما نسبيًّا، بما أن كلًّا منهما ينطوي على نمط واحد من الجسيمات الذرية المشحونة (المسمَّاة بالأيونات)، التي تستطيع معظم الخلايا التعرُّفَ عليها. أما اللذيذ فمتعلِّق بنوع واحد فقط من الجزيئات، وهو جلوتامات الصوديوم. لكنْ ظلَّ الحلو والمُر محيِّرين؛ لأنه يوجد العديد من العناصر المختلفة التي تحفِّز هذين المذاقين دون أن تتشابه بالضرورة بعضها مع بعض، وهذا مدهش بصفة خاصة بالنسبة إلى العناصر المُرَّة؛ إذ يمكن أن يكون لها العديدُ من البنى المختلفة، التي — بالنسبة إلى عالِم الكيمياء — لا تتشابه على الإطلاق، ولكن يظل مذاقُها كلها واحدًا.
بالنسبة إلى المختصين بعلم الأحياء الخلوي، يشير هذا إلى أن سطح الخلية المتخصِّصة في المذاق المُرِّ لا بد أنه يحتوي على العديد من المجسات المختلفة، المسمَّاة بالخلايا المُستقبِلة — واحدة لكلِّ نوع من الجزيئات المُرة المذاق التي يتعرَّف عليها — ويجب أن تستجيب جميع هذه المُستقبِلات لمحطة إشارات واحدة تُعِيد إرسالَ المقطع «مذاق مُر» إلى الخلايا العصبية، ثم إلى المخ في نهاية المطاف. وبالمقارنة مع الإدراكات الحسية الأخرى وحالات الإشارة الموجودة في الاستجابة الهرمونية، يتوقَّع العلماء أن تكون محطةُ الإشارة بروتينًا ينتمي لعائلة كبيرة معينة، وهي بروتينات «جي» G. تمَّ التعرُّف على أحد بروتينات «جي» المفترضة الذي يشترك في إشارات التذوُّق، عام ???? وسُمِّيَ جستدوسين (المشتق من اسم بروتين «جي» الذي يدخل في حاسة الإبصار، وهو ترانسدوسين). وحتى عام ????، لم يتم التعرُّف على مُستقبِل تذوُّقٍ واحد. وعندما اكتُشِف مُستقبِلان في نهاية المطاف عام ????، اتضح أنهما موجودان فقط في الخلايا التي تفتقر إلى الجستدوسين، وكان الأمر أشبه بعض الشيء بحفرِ نفقٍ من كلا الطرفين مع العجز عن بلوغ المنتصف؛ فبدلًا من بناء مسار ترانسدوسين إشاري كامل، يحظى الباحثون الآن بالمُستقبِلات دون بروتين «جي» المقابل، وبروتين «جي» الذي يفتقر إلى المستقبِل. لم تتحسَّن الأوضاع إلا عندما بدأ فريق تشارلز زوكر من جامعة كاليفورنيا في سان دييجو استخدامَ البيانات الجينومية في بحثهم عن مُستقبِلات المذاق؛ إذ عرفوا أن القدرة على تذوق مادة مُرة معينة تُسمَّى PROP يحدِّدها وراثيًّا جين غير معروف في منطقة معينة على الكروموسوم ?. عندما أصبح التسلسل النووي لهذه المنطقة متوافرًا في عام ????، استعانوا بعمليات بحث بمساعدة الكمبيوتر للتأكُّد مما إن كان يحتوي على أيِّ جينات تحمل شفرة إنتاج مُستقبِلات تشبه تلك التي تتواصل في العادة مع بروتينات «جي»، وقد وجدوا واحدًا أطلقوا عليه اسم «تي ? آر ?» T2R1، ثم واصلوا بحثهم عن جينات مماثلة لهذا الجين. وأثمر البحث عن ?? جينًا آخَر مرشَّحًا لإنتاج مُستقبِلات التذوق؛ مما يشير إلى أن هذه العائلة تستطيع امتلاكَ ما يصل إلى ?? عضوًا في أرجاء الجينوم. وعلى عكس الخلايا المُستقبِلة التي اكتُشِفت عام ????، فهذه شريك مقبول للجستدوسين، بما أن البروتينات تُنتج في نفس الخلايا. في واقع الأمر، أثبت زوكر وزملاؤه أن عناصر عائلة T2R ليست مرشحة محتملة فقط، ولكنها تمثل بالفعل مُستقبِلاتٍ وظيفيةً كاملة، حيث يتعرَّف كلٌّ منها على مادة مُرة معينة. ويمكن أن يتم هذا في المستنبتات الخلوية المشتقة من خلايا التذوُّق في الفأر؛ لأن المنطقة المقابلة في جينوم الفأر مشابِهة للغاية لتلك الموجودة في الإنسان، كما أن المُستقبِلات لدى الفأر يمكن التعرُّف عليها بسهولةٍ ومضاهاتها بتلك التي لدى الإنسان. إن الاكتشافات البحثية الرائدة في مجال معين أشبه بحافلات لندن، بل إنها أسوأ؛ فأنت تنتظر لسنوات أو حتى لعقود من الزمان، ثم تأتيك خمسة اكتشافات على التوالي. وهكذا، أعلَنَ أيضًا فريقٌ من جامعة هارفرد منفصل عن فريق زوكر أنه اكتشفَ عائلةً من مُستقبِلات المذاق المُر نتيجةً لفرز التسلسلات الجينومية المتاحة للحمض النووي لدى الفأر والإنسان. وقد اكتشف فريق جون كارلسون من جامعة ييل جزيئاتٍ ربما تكون مُستقبِلات الطعم في ذبابة الفاكهة «دروسوفيلا مالنوجاستر»، كما أفاد بحث آخَر بوجود مُستقبِل آخر للمذاق اللذيذ.
من الواضح أن الوقت قد حان من أجل التوصُّل إلى فهم عميق للإدراك الحسي عن طريق المذاق، وقد آنَ أوانه بالفعل. بغضِّ النظر عن الغياب الشديد المحرج للتفسير العلمي فيما يخص هذا الجانب الجوهري من حياتنا اليومية، فقد يؤدِّي الفهم المتعمِّق إلى تطبيقات مفيدة؛ فالدواء المعروف بمرارته يمكن تخفيف مذاقه بإضافة عامِلٍ مضاد للمرارة (بدلًا من محاولة تغطيته بالكثير من السكر)، ويمكن تغيير مذاق الطعام الصحي ليصبح أفضلَ من الطعام غير الصحي، وإذا كنت لا تحب ما تأكله، فربما يمكنك تغييرَ المذاق إلى شيء أفضل. والأهم من ذلك، يمكنك أن تُقِيم حوارًا مشوِّقًا في حفل عشاء بشأن آلية عمل حاسة التذوُّق.
(????)
أحدث التطورات

في عام ????، أعلن فريق تشارلز زوكر عن بروتينٍ مُستقبِل للأحماض الأمينية من النوع «إل» L؛ أيِ المسئولة عن المذاق اللذيذ. وقد وُجِد أنه يحتوي على جزيئين بروتينيين مختلفين (T1R1 وT1R3) يشترك أحدهما مع مستقبِل المذاق الحلو، T1R2:T1R3. قراءات إضافية

J. Chandrashekar et al., Nature, 2006, 444, 288.
G. Nelson et al., Nature, 2002, 416, 199.
X. Li et al., Proc. Natl Acad. Sci. USA, 2002, 99, 4692.

الفصل الثامن
دَعْ حُبَّك يتوهَّج!


تحمَّسْتُ تجاه اكتشافٍ مفاده أن الإثارة الجنسية تعتمد على استخدام نفس الرسول الجزيئي في اليراعات (وهي ليست بالضبط أقرب الكائنات شبهًا بنا) وفي ذكر الإنسان. وقد استعرضتُ الاحتمالات من خلال عمود صحفي ساخِر في جريدة «ناخريشتن»، ولكن المقال التالي هو النسخة التي حاولتُ فيها بكلِّ جهدي التزامَ الجديَّة.
خضعت الحياة العاطفية لليراعات إلى دراسات شديدة التفصيل، وذلك بالطبع لأسباب تلصُّصية في المقام الأول؛ إذ يستمتع العلماء بمراقبة الذكر وهو يضيء فانوسَه في سلسلةٍ من الومضات القصيرة (بضع مئات المرات في الملِّي ثانية) ليجذب الأنثى، التي تُرسِل عندئذٍ إشارةً لتعبِّر عن استعدادها. ومنذ الأعمال الكلاسيكية لويليام ماكلروي في أربعينيات وخمسينيات القرن العشرين، توصَّلَ علماءُ الكيمياء الحيوية إلى التفاعُل الضوئي الذي ينطوي على إنزيم (اللوسيفريز) وركيزته (اللوسيفرين) والأكسجين، ورصدوا إشارةً عصبيةً تتحكَّم في الومضات.
ولكن بما أن النهايات العصبية تبعد عن الخلايا المُصدِرة للضوء بحوالي ?? ميكرومترًا، فلم يكن من الواضح الكيفية التي من خلالها تسدُّ الإشارةُ هذه الفجوةَ. والآن، اكتشف باري تريمر وزملاؤه من جامعة تافتس (في مدينة مدفورد بولاية ماساتشوستس) أن اليراعةَ لكي تحظى بحياة عاطفية كاملة تعتمد على نفس جزيء الإشارة الذي يستخدمه الذكور في سلالتنا البشرية؛ أكسيد النتريك NO. درس تريمر سابقًا دورَ أكسيد النتريك في حشرات اليسروع، ولكن بعد سماعه محاضرةً عن اليراعات قرَّرَ أن يتأكَّدَ إذا ما كانَتْ تستخدِم هذا الجزيءَ أيضًا؛ فاكتشف أن التعبير عن إنزيم سينثاز أكسيد النيتريك في فانوسها يوحي بإمكانية ذلك، وعندما احتجز فريقه اليراعات في جوٍّ يحتوي على حوالي ?? جزءًا من المليون من هذا الغاز، استطاعوا أن يلاحظوا هذه الحشرات وهي تُصدِر وهجًا على نحوٍ مستمرٍّ، ولكي يُثبِتوا أن أكسيد النتريك يتفاعَل مع عضو الضوء وليس المخ، حضَّروا أيضًا حيواناتٍ عُطِّلت روابطُها العصبية بعضو الضوء. ومع أن هذه الحيوانات لم تكن قادرةً على إرسال الومضات تلقائيًّا، فإن تعرُّضَها لأكسيد النتريك مجدَّدًا أدَّى إلى إصدار ومضات سريعة أو حتى ضوء مستمر. وعلى العكس من ذلك، عندما حفَّزوا الفانوس بإمداده بالإشارة العصبية، استطاعوا إيقافَ الانبعاثات الضوئية بإضافة خلايا كاسِحة لأكسيد النتريك.
وبالتالي، يوجد دليل قاطع على أن أكسيد النتريك يشترك بصفته رسولًا في الخطوات النهائية من إرسال الإشارات، إلا أن ترتيبَ دوره في تسلسل الأحداث لا يزال غير واضح، ولكن يخمِّن تريمر أنه ربما يثبط عمليةَ التنفس في الخلايا الباعثة للضوء، وبالتالي يوفِّر الأكسجينَ الذي كانت الميتوكندريا ستستهلكه لولا ذلك. يتطابق هذا مع ملاحظة أن مثبطات أخرى لعملية التنفس (مثل السيانيد) تحفِّز أيضًا التوهُّج، كما أنه يشير أيضًا إلى آلية إيقاف الومضات القصيرة؛ فبما أن الضوء الأبيض يُوقِف تأثيرَ أكسيد النتريك عند التنفُّس في حالة الثدييات، فإن ضوء اليراعات قد يُطفِئ نفسَه بما تعنيه الكلمة حرفيًّا.
بالنظر إلى أن الإثارة لدى الرجال تحدث بفعل أكسيد النتريك نفسه (فهو ينشِّط تخليقَ أحادي فوسفات الجوانوزين الدوري cGMP، وهو تأثير يتم تعزيزه بواسطة عقَّار الفياجرا الذي يمنع تحلُّل هذا المركب)، فكل ما نحتاجه لنجعل حبَّنا يتوهَّج هو فانوس … (????)
أحدث التطورات

ظلَّ أكسيد النتريك يظهر في أماكن غير محتمَلة. على سبيل المثال، تشير تقاريرُ نُشِرت في شهر أكتوبر من عام ???? إلى أن السببَ الرئيسي وراء خطورة كثرة مرات التبرُّع بالدم على المرضى هو افتقاد أكسيد النتريك في الدم المُخزن. من الواضح أن الهيموجلوبين حامِل الأكسجين يحمل أيضًا أكسيدَ النتريك، الذي يعمل كإشارةٍ لتوسيع الأوعية الدموية؛ فهل يبدو لك هذا مألوفًا؟
قراءات إضافية

Educational web page on the firefly project: http://ase.tufts.edu/biology/firefly/.
B. A. Trimmer et al., Science, 2001, 292, 2486.

الفصل التاسع
جزيئات جاكوبسون


استكمالًا لموضوع الإشارات الجنسية: في عام ????، استهدَفَ علماء البيولوجيا الجزيئية مُستقبِلات الفيرومون المسئولة عن وظيفة عضو جاكوبسون في الفئران، تلك التي لا تزال غامضة إلى حدٍّ كبير. أعود فأكرِّر أن هذه نسخة من المفترض أنها جادَّة لمقالٍ كنتُ قد صغْتُه بأسلوب ساخِر، وأتطلَّعُ (بجديةٍ) إلى اليوم الذي يُتوصَّل فيه إلى تفسيرٍ لفيرومونات الإنسان ومُستقبِلاتها.
ملحوظة: انتبه إلى العبارة التي استعرتُها من كلمات أغنية ألانيس موريسات.
تقلقني إلى حدٍّ ما فكرةُ أن يقود الاستشعارُ الكيميائي اللاواعي في الفيرومونات سلوكَنا الجنسيَّ؛ مما يعني في نهاية المطاف أن جميع الألعاب الاجتماعية والتواصُل الفكري والإشارات الواضحة أو المستترة والمكائد البارعة والأفكار الرومانسية التي نستثمرها في لعبة المواعدة، قد يتحكَّم فيها نظامُ إشاراتٍ كيميائيٌّ نشترك فيه مع الفئران، بل حتى الحشرات أيضًا، وهو الذي يُعتبَر بدائيًّا للغاية لدرجة أن مخرجاته لا يسجِّلها المخُّ الواعي. إنه لَأمر رهيب!
لا عجبَ أن النظر بعين الاحترام إلى مثل هذه الأفكار قد استغرق وقتًا طويلًا. ومع أن العضو الميكعي الأنفي (المعروف أيضًا باسم عضو جاكوبسون نسبةً إلى أحد الباحثين الذي نشَرَ أوصافًا للأعضاء الميكعية الأنفية في الحيوان عام ????) قد اكتُشِف في الإنسان منذ حوالي ??? سنة، فإن وظيفته في الثدييات وخصوصًا البشر قد أثارَتِ الكثيرَ من الجدل منذ ذلك الحين. في منتصف القرن العشرين، زعمَتْ كتبُ التشريح أن العضو الميكعي الأنفي في الإنسان — لو وُجِد على الإطلاق — هو عضو غير وظيفي نتيجة التطور البيولوجي. ولكن مع بداية تسعينيات القرن العشرين ظهرت أدلة جديدة تدعم وظيفته.
إن الوضع بالنسبة إلى وظيفة العضو الميكعي الأنفي أوضَحُ في حالة الزواحف والثدييات المنتمية لغير الرئيسيات، خصوصًا القوارض. في سبعينيات القرن العشرين، ثبت أن الاستئصال الجراحي لهذا العضو في الفئران يؤدِّي إلى ضعفٍ حادٍّ في السلوك الجنسي والاجتماعي دون أن يؤثِّر ذلك على سلوك التعرُّف على الروائح المنفصلة، الذي يُعتبَر ضروريًّا من أجل التعرُّف على الطعام. وبالتالي، تأكَّدت وظيفةُ عضو جاكوبسون في نهاية المطاف على أساسٍ فسيولوجيٍّ، ولكن الجزيئات المشتركة في أدائه لوظيفته ظلَّتْ محيِّرة.
شكل ?-?: العضو الميكعي الأنفي لجنين بشري.
تعمل الفيرومونات بتركيزات منخفضة للغاية، وغالبًا في خليطٍ متوازِنٍ على نحوٍ معقَّدٍ يصعب تحليله. أضِفْ إلى هذا حقيقةَ أنها لا تتفاعَل مع مخنا الواعي؛ ولهذا يتضح لنا السببُ وراءَ ندرة ما نعرفه عنها. فقط بعد أن أجرى علماءُ البيولوجيا الجزيئية تحليلًا منهجيًّا لجينوم الفأر، استطاعوا أن يفهموا بعض مُستقبِلات الفيرومون في الثدييات، التي يُحتمَل أن يوجد منها أكثر من مائة.
في عام ????، كان ريتشارد أكسل وزملاؤه بجامعة كولومبيا في نيويورك أول مَن نجح في تغيير السلوك الجنسي والاجتماعي للفئران باستئصال الجين المسئول عن إنتاج بروتين محدَّد في العضو الميكعي الأنفي. وكان البروتين الذي استهدفوه عبارة عن قناة هوابط (كاتيونات) — وهو بروتين موجود في الغشاء الخلوي يمكنه أن يتيح للأيونات الموجبةِ الشحنة المرورَ بالغشاء — اسمه «تي آر بي ?» trp2. أنتج الباحثون سلالةً من الفئران الطافرة تفتقر إلى كلتا نسختَي هذا الجين (ولهذا تُعرَف باسم الفئران المنتقصة جينيًّا)، ولكنها بَدَتْ طبيعيةً وموفورةَ الصحة. كشفت الأبحاث السلوكية عن الفئران الطافرة عددًا من الخصائص الغريبة؛ فذكور الفئران الطافرة كانت أقلَّ عدائيةً تجاه المعتدين وأكثر ميلًا إلى ممارسة الأنشطة الجنسية المِثلية، كما كانت الإناثُ أقلَّ عدائيةً في الدفاع عن أبنائها ضدَّ المعتدين. ويشير النطاق الواسع من التغييرات التي نجمَتْ عن انتقاص هذا الجين الواحد؛ إلى أن ثمة دورًا عامًّا لهذه القناة الأيونية في إشارات العضو الميكعي الأنفي، وليس دورًا متخصِّصًا في مسارٍ واحد فقط. أعلَنَ فريقٌ بقيادة بيتر مومبرتس من جامعة روكفيلر في نيويورك أولَ خطوة تجاه التعرُّف على المُستقبِلات الجزيئية المسئولة عن وظيفة العضو الميكعي الأنفي، علاوةً على الفيرومونات التي يمكن أن ترتبط بها، وحدَّدَتِ الدراسات التي أُجرِيت على جينوم الفئران أكثرَ من ??? جين مرشَّح لإنتاج مُستقبِلات العضو الميكعي الأنفي، المعروفة الآن جميعًا بالعائلة الكبرى V1r. ركَّزَ فريق مومبرتس على تكتُّلٍ مكوَّنٍ من ?? جينًا من هذه الجينات كان موجودًا في الكروموسوم ?، ومحتويًا على معظم أعضاء مجموعتين أصغر، هما العائلتان الفرعيتان V1ra وV1rb. أنتج الباحثون فئرانًا طافرة عن طريق حذف هذا التكتُّل الجيني بأكمله، ثم درسوا سلوكها. كما كان متوقَّعًا، شُوهِدت تغيُّرات ملحوظة في السلوك الجنسي لهذه الفئران الطافرة، وكانت مختلفة على نحوٍ مميَّز عن تلك المُحفَّزة بكلٍّ من انتقاص جين trp2 والاستئصال الجراحي للعضو الميكعي الأنفي. وكانت إحدى الملاحظات المهمة هي أن الفئران المُستقبِلة المنتقصة جينيًّا (مثل الفئران التي استُؤصِل العضوُ الميكعي الأنفي منها) قد اعتراها شعورٌ متزايِد بالملل من الجنس، في حين أن فئران النمط البري وتلك الطافرة بجين trp2 زاد اهتمامها به كلما زادت تجربتها. ويشير هذا الاكتشاف إلى أن العضو الميكعي الأنفي يجعل سلوكياتٍ معينةً تبدو مثمِرة. عند هذه المرحلة، تُثبِت التجاربُ بصفة أساسية أن ثمة رابطًا واضحًا بين الجينات التي يتمُّ التعبيرُ عنها في العضو الميكعي الأنفي وبين أنواعٍ معينة من السلوكيات الجنسية والاجتماعية، على الأقل في القوارض. وسيكون من اللازم إجراءُ المزيد من الدراسات التي تتناول الجيناتِ المنفردةَ والنواتجَ البروتينية والفيرومونات، إلى جانب التفاعلات وشبكات الإشارات بطول مُستقبِلات الفيرومون، لتحديد ما يحدث بالضبط في «الأنف الثانية».
ويظلُّ ثمة أمر مهم حول إن كان كلُّ هذا ينطبق أيضًا على البشر أم لا. مع أنه توجد مزيلات عرق في المتاجر تتعامَل ظاهريًّا مع عضو جاكوبسون، فإنه سيمر وقت طويل إلى حين يمكن تفسير هذه الجاذبية المتعذَّر تفسيرُها. ولكن بوجود مُستقبِلاتِ القوارض كعلامةٍ حيويةٍ، والبياناتِ المتاحة عن الجينوم البشري، سيكون من الممكن تعقُّبُ مُستقبِلات العضو الميكعي الأنفي في الإنسان واختبارُ هذه المنتجات عليها. وبناءً عليه، إذا كنتَ تخشى غرائزك الحيوانية، فقد تكون قادرًا على التحكُّم فيها في المستقبل، ولكن قد تصبح الحياةُ عندئذٍ أقلَّ إمتاعًا.
(????)
أحدث التطورات

للأسف ليس كثيرًا، وما زلتُ في انتظار خروج مُستقبِلات الفيرومون البشرية من مخابئها!
قراءات إضافية

L. Watson, Jacobson’s organ, Allen Lane, 1999.
B. G. Leypold et al., Proc. Natl Acad. Sci. USA, 2002, 99, 6376.
K. Del Punta et al., Nature, 2002, 419, 70.

الفصل العاشر
علوم عائلة سيمبسون


حسنًا، لا أعتقد أنني مضطر إلى تفسير سبب استمتاعي بكتابة هذا المقال. لقد خطرَتِ الفكرةُ ببالي ذاتَ صباحٍ بينما كنتُ أصطحب ابنتي المعجبة بمسلسل عائلة سيمبسون إلى مدرستها.
لم أستطِعْ أن أفهم قطُّ جدوى المسلسلات التليفزيونية؛ فقد بَدَتْ لي مثلَ الكنيسة، عبارة عن تمرينات متكرِّرة للمخلصين فقط، ولها جانب تنويري ضعيف نسبيًّا، ولكني اضطررتُ إلى مراجعة اتهامي العام لكل الأمور المرتبطة بالحلقات التليفزيونية عندما أدمنَتِ ابنتي الصغرى مسلسلَ «عائلة سيمبسون»، ووجدتُ نفسي شيئًا فشيئًا مُنجذِبًا إليه أنا أيضًا. بالنسبة إليها، كان انجذابها أساسًا تجاهَ اللون الأصفر الذي تتميَّز به الشخصيات؛ إذ تظهر الشخصيات ككائناتٍ صفراء باللون المفضَّل لها. وبالنسبة إليَّ، فلا بد أن الأمر مرتبطٌ بالرؤية الساخرة التي يقدِّمها المسلسلُ عن العلوم، التي لا تزال مع ذلك شديدةَ التعقيد.
من الواضح جدًّا أن صانعي مسلسل «عائلة سيمبسون» يعملون بمنطق علميٍّ؛ فصميم موضوع بحثهم، وهو عائلة سيمبسون نفسها، عبارة عن منظومةٍ محاصَرةٍ في توازُنٍ ديناميكي ولكنه شديد الاستقرار. وعلى مدى أكثر من ?? عامًا وأكثر من ??? حلقة، لم يتغيَّر شيء فعليًّا، حتى الأبناء لم يكبروا في السن؛ فبارت وليزا ما زالَا في نفس الصف بالمدرسة، وماجي لم تزل تمص دميتها. وعلى الرغم من أن سياسة ثبات العمر شائعةٌ في عالم الأفلام الكارتونية، فوحدهم العلماء من أمثال الفريق المنتِج لعائلة سيمبسون هم مَن سيبالغون في الاهتمام ليضمنوا ثباتَ الظروف التي انطلقوا منها في كلِّ ما يفعلونه.
في كل حلقة، يغيِّر المؤلفون جانبًا واحدًا فقط كي يستكشفوا مدى استجابة النظام المتوازِن. وقد يؤثِّر التغييرُ مؤقتًا على العديد من سكان مدينة سبرينجفيلد، ويقلب عالَمَهم الصغير رأسًا على عقب، ولكن قرب نهاية الحلقة، يكون النظامُ قد عاد إلى وضعه الأول. ويتيح لنا المسار المتعرج الذي يعود به على نحوٍ مفاجِئٍ ملاحظةَ آلياتِ التفاعل بين مكونات النظام. على سبيل المثال، يكسر هومر فكَّه ويكون عليه ارتداءُ مُقوِّم لا يتيح له الكلام، ولكي يخرج من عزلته، يشجِّع الآخَرين على التحدُّث إليه عن مشكلاتهم ويتعلَّم أن ينصت إليهم؛ وبالتالي ينظر إليه جميعُ مَن حوله على أنه شخص مُراعٍ لهم ومتفهِّم. كما تتضمَّن الاضطرابات الأولية الأخرى نقل بارت وليزا إلى صفين مختلفين أو مدرستين مختلفتين، واكتشاف مارج من جديدٍ معجبيها في المدرسة الثانوية، ووقوع الجد سيمبسون في الحب. وتحفِّز كلٌّ من هذه التجارب (و??? تجربة أخرى) تفاعلات رئيسية، ولكن يمكنك أن تطمئنَّ إلى أنه بنهاية الحلقة سيكون كلُّ شيء قد عاد إلى وضعه المتوازن الأول.
الاستثناء الجدير بالذكر لهذه القاعدة والذي يحدث مرةً واحدة في السنة هو حلقات عيد القديسين، التي تشكِّل حلقاتٍ مصغَّرةً بعنوان «بيت الشجرة المرعب الصغير». ففي إسقاطٍ تامٍّ للسياسة العامة، تعرض هذه الحلقات أحداثًا «سحرية» وغير واقعية تتراكم لتشكِّل كوارثَ كبرى، مُبتعِدةً أكثر عن الوضع الطبيعي. وبينما تعكس الحلقات العادية موقفَ «التقييم السلبي»، حيث تؤدِّي التغييرات إلى أحداثٍ ترجع في نهاية الأمر إلى وضعها الأول، فإن حلقات عيد القديسين تعكس تقييمًا إيجابيًّا، حيث يمكن أن يؤدِّي تغييرٌ صغيرٌ إلى كارثة كبرى، ليسيطر على الكوكب في نهاية المطاف الدلافين أو الموتى الأحياء أو الكائنات الفضائية.
الدليل المادي على التفكير العلمي وراء هذا المسلسل موجودٌ في العديد من النكات المبنية على العلم، التي تعرِضُ قوانينَ الديناميكا الحرارية والطاقة النووية والتطوُّر البيولوجي (التي غالبًا ما تحفِّزها التسريبات الإشعاعية الصادرة من المصنع الذي يعمل به هومر). وتتجسد التكنولوجيا الحديثة ليس فقط في محطة الطاقة النووية الموجودة دائمًا، ولكن تتجسد أيضًا في إنجازاتٍ مثل خط السكة الحديد الفردي. صحيحٌ أن المسلسل لا ينتقد التكنولوجيا في حدِّ ذاتها، إلا أنه يُرجِع فشلَها إلى غباء مُشغِّليها (على سبيل المثال: هومر سيمبسون واستجابته للانصهار النووي الوشيك بممارسته لعبة «حادي بادي» في اختياره لأزرار التحكُّم في المحطة النووية)، وجشع مالكها (السيد بيرنز)، وسذاجة مستهلكيها، مثل سكان سبرينجفيلد الذين يختارون مشروعَ خط السكة الحديد الفردي المعيب والعديم الجدوى بدلًا من التطويرات الحقيقية في بنيتهم التحتية.
يُعتبَر غياب المعرفة العلمية لدى الجمهور موضوعًا متكرِّرًا في المسلسل، ويمثِّل هومر بالطبع النموذجَ المفتقِر تمامًا إلى المعرفة العلمية. وربما تنكشف أميته في الأمور العلمية — في أكثر صورها فجاجةً — عندما تلعب الأسرة لعبةَ سكرابل فيتذمَّر شاكيًا: «لا يستطيع أحدٌ أن يكوِّنَ كلمةً بهذه الحروف.» ثم نرى الحروف مرتَّبةً أمامه: O X I D I Z E؛ أيْ «يتأكسد». ومع أن عمله في مصنع الطاقة النووية يتطلَّب من الناحية النظرية بعضَ المعرفة بعلم الفيزياء، فإن من النادر أن نجد لمحاتٍ عن فهمه. وأحيانًا يكون هومر مُضحِكًا حتى وهو يدافع عن المعتقدات العلمية القديمة أمام ليزا، المشغولة باختراع «الحركة الدائمة» من أجل مشروعٍ للمدرسة، وتصرخ: «إننا في هذا البيت نحترم قوانين الديناميكا الحرارية!» كما تتجسَّد المخاطر الجمة الناتجة عن الجهل في طالِب الطب المحتال د. نيك ريفييرا الذي لا يعرف أن الأشياء المكتوب عليها «قابل للاشتعال» يمكن أن تشتعل، والذي يُجرِي جراحةً في قلب هومر دون أن يعرف مطلقًا أيُّ شريان دموي يتصل بأية حجرة من حجرات القلب. لكن ليزا، على العكس، هي الشخصية التي يمكن اللجوء إليها بحثًا عن إجابات علمية صحيحة عن أيِّ شيءٍ، بدءًا من علم الفلك ووصولًا إلى علم الحيوان، حتى إنها في بعض المناسبات تُجرِي تجاربَ علمية حقيقية، كحالها — على سبيل المثال — عندما تعزل الفيرومون الذي يجعل المتنمرين يهاجمون الأغبياء، وعندما تقيس ذكاءَ بارت مقارَنةً بذكاء هامستر. إلا أن براعتها العلمية لا تفيدها كثيرًا؛ إذ إن معظم الشخصيات الأخرى أغبى من أن تُقدِّر معرفتها، كما أنها تفتقر إلى القدوة، بما أن العالِم الوحيد الذي يظهر بانتظامٍ هو شخص أحمق على شاكلة «المخترعين المجانين». وهكذا، فمن خلال تطبيق مسلسل «عائلة سيمبسون» للأسلوب العلمي في التحليل التجريبي على مجال مسلسلات الكارتون، فإنه يقدِّم بعضَ الدروس التنويرية للعلماء في الحياة الواقعية.
إلا أن الخبر السار أن هذه صياغة تليفزيونيةٌ يمكنك فيها أن تذكر الديناميكا الحرارية دون تخويف الناس منك. وبما أنني وأبنائي أوشكنا على الانتهاء من مشاهدة جميع الحلقات، وتوجد احتماليةٌ بأن يتوقَّفَ عرض مسلسل «عائلة سيمبسون» في مرحلةٍ ما، فإننا في أمسِّ الحاجة إلى المزيدِ من المسلسلات التليفزيونية التي يصنعها أشخاصٌ يهتمون بالفهم العلمي، وليس بإبهار مشاهديهم بالثرثرة التكنولوجية. بعبارة أخرى: لا تقدِّموا لنا مزيدًا من الكريبتونايت ومحرك الالتواء الزمكاني، وقدِّموا لنا مزيدًا من محطات الطاقة النووية والأسماك الثلاثية العيون.
(????)
أحدث التطورات

في مراتٍ لاحقة أثناء اصطحاب ابنتي إلى المدرسة، تفكَّرْتُ مليًّا في خيار توسيع هذا الموضوع في صورة كتاب، لأتبع المنهاجَ العريق الآن في كتاب «فيزياء ستار تريك» لمؤلِّفه لورانس كروس. لكني لم أستطِعْ قطُّ تنظيمَ أفكاري لتأليف هذا الكتاب، إلا أن عالِم الفيزياء والكاتب العلمي بول هالبيرن من فيلادلفيا كتَبَ بالفعل مثلَ هذا الكتاب، وقد ظهر عام ???? (في توقيت عرض فيلم عائلة سيمبسون). انظر القراءات الإضافية.
قراءات إضافية

P. Halpern, What’s Science ever done for us? Wiley, 2007.

الفصل الحادي عشر
كنوزٌ محيِّرة


فكرتُ لوهلةٍ في تحويل المقال التالي إلى كتاب، مختزلًا حياةَ فريتز هابر وأعماله الهائلة في حجم معقول بالتركيز على هذا الجانب من أعماله غير المعروف والغريب والمحكوم عليه تمامًا بالفشل. ثم خشيتُ من الأبحاث الإضافية التي تتطلَّبُها كتابةُ السيرة الذاتية واقتصرت على هذا التناول القصير، الذي يعود بنا إلى الموضوع المثير المتعلِّق بالعنصر ??، المعروف باسم الذهب.
إذا تعلَّق الأمر بممارسة لعبة «ست درجات من التباعد» مع علماء الكيمياء، فأنا في الموضع المناسب. على سبيل المثال: فريتز هابر (????–????) — تلك الشخصية التراجيدية على نحو بارز والحائزة على جائزة نوبل — على مقربة ثلاث خطوات فقط مني؛ إذ إن يوهانِز جينيكه هو المشرف السابق على رسالة الدكتوراه خاصتي، وهو ابن مساعِد هابر وكاتب سيرته الذاتية في المستقبل. وأعتز بهذه العلاقة لأنها تُلقِي بعضَ الضوء غير المعتاد لحدٍّ ما على هذا الرجل العظيم.
إنَّ كل الجوانب المعروفة من سيرة حياة هابر لها أثر عظيم في التاريخ وفي حياة الناس؛ فنظرًا إلى كون هابر مواطنًا ألمانيًّا تحلَّى بالوطنية الشديدة خلال الحرب العالمية الأولى، فقد ساعَدَ في تصميم أسلحة كيميائية وأشرَفَ على استخدامها في جبهة القتال، وعلى الرغم من وعيه بالمعاناة الشنيعة التي تسبِّبها، فإنه ظنَّ أنها ستجلب نهايةً سريعة للحرب، وبالتالي تقلِّل من إجمالي الوفيات. إلا أن زوجته الشابة، كلارا إميروار، التي كانت من أولى النساء اللاتي ينلن دكتوراه في الكيمياء، لم توافقه الرأي وانتحرَتْ بعد أن فشلت في منعه. وعلى الجانب الآخَر من المعادلة، يمكن للمرء أن يقدِّر لهابر أن قرابة نصف كمية النيتروجين الذي يغذِّي سكان العالم اليوم مصدره العملية التي اخترَعَها والتي أسماها عملية هابر-بوش. وقد اختتم مسيرة حياته المعقدة بنهاية تراجيدية؛ إذ اضطر إلى الهروب من ألمانيا النازية، ومات في سويسرا وهو في طريقه إلى مدينة رحوفوت، حيث عرض عليه حاييم وايزمان منصبًا.
قضى مساعِد هابر السابق يوهانز جينيكه، مع زوجته، عقودًا من الزمان وهو يجمع موادَّ تصلح للسيرة الذاتية، التي لم ينتهِ منها قطُّ نظرًا إلى كبر حجم المهمة وضعف بصره بعدما كبر في العمر. (السيرتان الموجودتان حاليًّا اللتان كتبهما كلٌّ من ديتريش شتولتسينبِرج ودانيل تشارلز تعتمدان إلى حدٍّ كبير على المادة التي جمعها جينيكه.) أحد المشروعات البحثية التي شارَكَ فيها جينيكه بنفسه تمَّ فيما بين الحربين العالميتين، ويُلقِي ببعض الضوء على الحياة الفاوستية لهابر. ففي ربيع عام ????، فاجَأَ هابر كلًّا من جينيكه وزملاءَ آخَرين عندما أعلَنَ أنه يريد دراسة احتمالية استخلاص مادة الذهب من ماء البحر، والتي قُدِّر أنها ما بين ? و?? أجزاء من المليار. وقد اعتقد أن هذا الرقم لو كان صحيحًا، فسيكون استخلاصُ كميات كبيرة من الذهب عمليًّا من الناحية الاقتصادية، وقد يساعد ألمانيا في سداد ديونها الثقيلة الناجمة عن الحرب العالمية الأولى ومعاهدة فِرساي.
شكل ??-?: الفريق الذي حاوَلَ استخلاصَ الذهبِ من ماء البحر. يقف فريتز هابر في الوسط، ويوهانِز جينيكه إلى يمينه.
شكَّلَ هابر فريقًا بقيادة يوهانِز جينيكه لتطوير هذا المشروع بشكل أكبر. وطوال خمس سنوات، عمل ?? باحثًا وطالب دكتوراه في سريَّة تامة على مشروع الذهب، وعلى الرغم من إعلام الرُّعاة الصناعيين، بما في ذلك شركة ديجوسا، ظلَّ المشروع سرًّا مخفيًّا عن سلطات الحلفاء. في البداية، عمل الباحثون على تحسين تقنيات التحليل والعَزل، وعلى الرغم من أن عدد عينات ماء البحر المتاحة كان محدودًا، فقد أكَّدَتْ تحليلاتهم فيما يبدو أن مادة الذهب تقع في نطاق الجزء من المليار. ولإجراء عملية العزل، اختبروا مناهِجَ مختلفةً واستقروا في النهاية على ربط الذهب بالكبريت الغرواني والتنقية بواسطة الرمال المشبَّعة أيضًا بالكبريت.
بحلول صيف عام ????، كانت التجاربُ جاهزةً لنقلها إلى سفينة حقيقية مُبحِرة في عرض المحيط. صعد فريقٌ من الباحثين، منهم هابر نفسه، وهم لا يزالون محتفظين بسرية المشروع التامة، إلى متن سفينة الرُّكاب هانزا المتجهة إلى نيويورك، حيث كانوا مسجَّلين رسميًّا بأنهم من طاقم السفينة. ويشاع أن هابر كان سعيدًا للغاية لاعتباره «محاسِبًا زائدًا على العدد». وفي الوقت الذي عمل فيه علماء الكيمياء خلف الأبواب المغلقة، انتشَرَتِ الشائعات وسط الرُّكاب انتشارَ النار في الهشيم، وبمجرد وصول السفينة إلى نيويورك، أعلنت إحدى الجرائد: «علماءٌ ألمان يبحثون عن طرق لقيادة السفن باستخدام قوةٍ خفية.» ثم أُرسِلت بعثة ثانية في خريف نفس العام أخذت فريق هابر إلى الأرجنتين.
قدَّمَتِ العيناتُ التي جُمِعت خلال هاتين الرحلتين نتائجَ مختلفة تمامًا، بحيث اضطر الباحثون إلى العودة إلى المعمل وتحسين طرقهم التحليلية أكثر، واستثناء مكاسِب الذهب (من المواد الكيميائية الشائعة، أو التراب، أو المجوهرات) وخسائره (بدءًا من الامتصاص إلى المعدات). وتمَّتْ تعبئة آلاف الزجاجات بعينات من ماء البحر من جميع أنحاء الكرة الأرضية، وتخزينها في صناديق خشبية مصمَّمة خصوصًا لهذا الغرض، وشحنها إلى برلين لفحصها. ومع هذا، كانت النتيجة المحبِطة للآمال أن مادة الذهب الحقيقية في معظم العينات كانت أقلَّ بمقدار قيمتين أسيتين مقارَنةً بما أشارت إليه التحليلات السابقة؛ مما استبعَدَ أيَّ أملٍ في الإصلاح الاقتصادي. وفي عام ????، نشر هابر نتائجه وألغى المشروع.
مع أن هذا المشروع فشل في تحقيق هدفه، فإنه طوَّر بالفعل الوسائل التحليلية، كما ساعَدَ في توفير تمويل لأبحاث هابر خلال الأوقات العصيبة. والمثير أكثر للمفارَقة أن المشروع لو كان وفَّرَ كميات هائلة من الذهب؛ لَأتى تخفيضُ قيمةِ هذا المعدن النفيس بنتائجَ عكسيةٍ. وحسبما اكتشَفَ الإسبان بعد سلب ذهب السكان الأصليين في أمريكا اللاتينية، فإن «إيجاد» أطنان من الذهب لا يجعلك تلقائيًّا غنيًّا على المدى البعيد؛ فالنيتروجين المأخوذ من الهواء كان أقل إبهارًا، ولكنه في نهاية المطاف يفوقه قيمةً.
(????)
أحدث التطورات

يُعتبَر التنقيبُ في المحيطات موضوعًا يتكرَّر بمعدلاتٍ منتظمة في صور جديدة وقديمة. وغالبًا ما يسعى الناسُ هذه الأيام إلى عناصر مثل المنجنيز، ولكن مع تحسُّن الوسائلِ المعملية بمرور الوقت، لن أتفاجَأَ إذا أعادَ أحدٌ فتحَ البحثِ القديم عن ذهبِ المحيط.
قراءات إضافية

D. Stoltzenberg, Fritz Haber: Chemist, Nobel Laureate, German, Jew, Chemical Heritage Foundation, 2005.
D. Charles, Master Mind: The Rise and fall of Fritz Haber, the Nobel Laureate Who Launched the Age of Chemical Warfare, Ecco, 2005.
R. Hahn, Fritz Haber’s (1868–1934) Forschungen zur Gewinnung von Gold aus Meerwasser, Master’s thesis, Technical University of Berlin, 1995.

الفصل الثاني عشر
البويضات والحيوانات المنوية والروك آند رول


إلى اليوم، يبدو أن بريطانيا تواجِه العديدَ من الأزمات فيما يتعلَّق بموضوعَي الجنس والمخدرات؛ وهو ما يؤدِّي إلى مشكلاتٍ بالغة مثل ارتفاع معدلات الحَمْل لدى المراهقات، وانتشار الإسراف في الشراب. لكن الأكثر إثارةً للدهشة أن نفسَ هذه الدولة قد لعبتْ دورًا رائدًا في التلقيح الصناعي. مهلًا، ربما يوجد هدف من هذا الجنون؛ لعلهم يقولون: لا نريد الجنس من فضلك، ولكننا نفضِّلُ التلقيحَ الصناعي بدلًا منه. وفي جميع الأحوال، فإن التلقيح الصناعي قد أكسَبَ بريطانيا دورًا رائدًا عندما ظهَرَ الجدالُ حول الاستنساخ والخلايا الجذعية.
تتصدر الصحفَ كلَّ أسبوع تقريبًا المسائلُ الأخلاقية البيولوجية التي تحيط بالتكاثر البشري والأجِنَّة والخلايا الجذعية، ويستتبعها مباشَرةً مشاهدتك لأنباءٍ عن استنساخ أجِنَّة بشرية بغرض إنتاج الخلايا الجذعية (الاستنساخ العلاجي)، ومناقشات حول إخفاء هوية المتبرِّعين بالحيوانات المنوية، والانتقاء الجنسي، وادِّعاءات من علماء مستقلين عن الاستنساخ، والاندماجات بواسطة التلقيح الصناعي، والأجِنَّة «المُهندَسَة وراثيًّا» … إلخ.
تؤثِّر هذه الموضوعات وغيرها على معظم الدول الأوروبية بطريقةٍ ما، مع أن كلًّا منها يتسم بمزيج من العلم والدين والسياسة قد يثير التساؤلات. ففي ألمانيا، على سبيل المثال، أدَّتْ ذكرياتهم عن علم تحسين النَّسْل (اليوجينيا) في زمن النازية إلى تشريع مانع تمامًا وجدل شعبي قوي.
تُعتبَر المملكة المتحدة محظوظة نسبيًّا في أن السلطة التي تتعامَل مع هذه المسائل كانت موجودة بالفعل قبل أن يبدأ الحديث عنها. فقد أُنشِئت هيئةُ الخصوبة البشرية وعلم الأجِنَّة (www.hfea.gov.uk) في أغسطس ????، بناءً على قانونٍ تمت الموافقة عليه في العام السابق، وتتمحور مهامها الأساسية حول: ترخيص عيادات التلقيح الصناعي والإشراف عليها.
ترخيص أبحاث الأجِنَّة البشرية والإشراف عليها.
تنظيم تخزين الأمشاج والأجِنَّة.
علاوة على هذا، فإنها تمارس أيضًا دورًا استشاريًّا لصالح الحكومة والشعب. ومع أن هذه النبذة قد بَدَتْ حتمًا خاليةً من السوء عام ????، فإنها قد اتسعت منذ ذلك الحين لتضمَّ نطاقًا كبيرًا من القضايا الأخلاقية البيولوجية الشديدة الحساسية.
إنَّ هيئة الخصوبة البشرية وعلم الأجِنَّة، الكائِنة في شرق لندن بالقرب من محطة شارع ليفربول، عبارة عن هيئة مكوَّنة من أعضاءٍ يلتقون مرةً شهريًّا، بالإضافة إلى كونها مصلحةً حكومية يعمل بها موظَّفون مدنيون وتحظى بميزانية قيمتها حوالي مليونَيْ جنيه إسترليني. يمارس مجلس إدارة الهيئة دورًا إشرافيًّا داخل هيكل المصلحة، وقد ترأَّسَتِ الهيئةَ روث ديش — أستاذة القانون ومدير كلية سانت آن في جامعة أكسفورد — منذ إنشائها وحتى ربيع عام ????، وجاءت بعدها سوزي ليذر التي تتمتَّع بخلفية في العلوم السياسية والشئون الاستهلاكية، وقد كانت نائبَ رئيس مجلس الإدارة في وكالة معايير الغذاء من عام ???? وحتى ????.
إنَّ إحدى كبرى المُعضلات الأخلاقية التي تواجه هذه الهيئةَ على مدار السنوات القليلة الماضية هي قصة السماح بانتقاء أجِنَّةٍ للحصول على أعضائها البشرية التي قد تنقذ حياة أشِقَّائها. وبناءً على خلفيةٍ أساءَ الإعلامُ تمثيلَها، حين صاغ مصطلحَ «الأجِنَّة المُهندَسَة وراثيًّا» على الرغم من عدم وجود أية هندسة جينية مُبتكَرَة في هذه العملية من الأساس؛ حكمت الهيئةُ بأن انتقاء جنين بناءً على التشخيص الجيني لما قبل زراعة الأعضاء غير مسموح به، إلا إذا كان يضمن أن الطفلَ الناتج من المعالجة سيكون خاليًا من الأمراض الوراثية. وإذا استطاع أيضًا — إلى جانب تمتُّعه بالصحة — أن يوفِّر خلايا جذعيةً من الحبل السري قد تساعد في شفاء شقيقه، فسيكون ذلك أفضل. وعلى العكس من ذلك، رفضَتِ الهيئةُ أن تسمح للأبوين باستخدام التشخيص الجيني إذا كان الغرضُ منه فقط هو مصلحة الشقيق المريض في الحالات التي لن يكون فيها الطفلُ الجديد معرَّضًا لخطر الإصابة بالأمراض الوراثية.
بناءً على هذا، رفضت الهيئة أن تسمح لعائلة الطفل الصغير تشارلي ويتيكر بإنتاج شقيقٍ له ذي أنسجة مطابقة لأنسجته بواسطة التشخيص الجيني (وهو ما لم يمنع العائلة على الرغم من ذلك من إجراء العملية في الولايات المتحدة). من ناحية أخرى، وافقَتِ الهيئة على هذا الإجراء لعائلة زين هاشمي؛ فبما أن المرض الذي أصابَ زينًا في الدم، وهو أنيميا البحر المتوسط، مرض وراثي، فإن التشخيص الجيني لن يساعد فقط في إنتاج شقيق ذي أنسجة مطابقة لأنسجته، ولكنه سيضمن أيضًا أن المولود الجديد لن يكون حاملًا للمرض.
اهتزَّتْ ثقة الناس في سلطة الهيئة في ديسمبر من عام ????، عندما حكمت المحكمة العليا بأن هيئة الخصوبة البشرية وعلم الأجِنَّة لا تملك الحقَّ في منح عائلة هاشمي هذه الموافقة. ولكن في أبريل ????، أطاحت محكمة الاستئناف بهذا القرار وكفلت لعائلة هاشمي حريةَ إجراء العملية بغضِّ النظر عن نتائج أيِّ إجراءٍ قانوني آخَر. وحاليًّا، تباشِر لجنةٌ من داخل الهيئة اتخاذَ القرار بشأن هذه الحالات جميعًا على أساس فردي، بعد المعيار المتعسِّف المذكور أعلاه.
من خلال دور الهيئة في الإشراف على أبحاث الأجِنَّة، فإنها مسئولة أيضًا عن تحديد مَن يُسمَح له بإنتاج خلايا جذعية جنينية في المملكة المتحدة. وحتى الآن لم تمنح إلا ثلاثة تراخيص لإنتاج خطوط خلايا جذعية جديدة، الأول ذهَبَ إلى كلية الملك في لندن، حيث نجح فريق ستيفن مينجر في إنتاج أول خط خلايا جذعية من الأجِنَّة البشرية في المملكة المتحدة. أما أحدث ترخيص فمُنِح في يونيو ???? لمعهد روزلين بالقرب من إدنبرة، وهو المشهور باستنساخ النعجة دُولِّي.
صحيحٌ أن ظهور هيئة الخصوبة البشرية وعلم الأجِنَّة على الساحة الأخلاقية البيولوجية مبكرًا يعني أنها قد كوَّنت لنفسها هيكلًا وسُمعةً بمجرد أن زادَتِ الأوضاعَ تعقيدًا، إلا أنه يعني أيضًا أن التشريع البرلماني عام ???? الذي أُنشِئت على أساسه لم يكن بإمكانه توقُّعُ معظم المشكلات التي تواجهها الهيئة حاليًّا. ففي المؤتمر السنوي للهيئة في يناير ????، أطلقَتْ سوزي ليذر مبادرةً لمراجعة القانون القديم، معلِّلةً الأمرَ بأن بعض بنود هذا القانون قد أصبحت «باليةً في الوقت الحالي». على سبيل المثال: تناولَتِ الشرطَ القانوني الذي يُلزِم أطباءَ التلقيح الصناعي بالاعتناء ? «حاجة الطفل إلى أب» قبل إجراء العملية. ومن المُزمَع أن تقدِّم الهيئةُ مراجعتها للقانون إلى الحكومة بنهاية هذا العام، ولكن يبدو أنه من المحتمَل أن تُعقَد جلساتُ تشاوُرٍ في ????؛ مما يعني أنه قد يمر بعضُ الوقت قبل الموافقة على قانون جديد. ومثل سباق أليس أمام الملكة الحمراء، سيكون على المُشرعين زيادة الخُطى على نحو أسرع كي يواكِبوا التغييرات التي تحدث في مجال الخصوبة وأبحاث الأجِنَّة. وفي غياب أيِّ حلٍّ مثالي لهذه المشكلة الجوهرية المتعلقة بالتكنولوجيا السريعة التطور، يبدو أن وجودَ هيئة الخصوبة البشرية وعلم الأجِنَّة — المعروف عنها اتخاذها لقرارات موزونة — أمرٌ مفيدٌ.
(????)
أحدث التطورات

المثير للدهشة أن هيئة الخصوبة البشرية وعلم الأجِنَّة قد صمدت خلال فترة رئاسة توني بلير لمجلس الوزراء دون أن تتعرَّض للخصخصة أو إعادة الهيكلة. وبدايةً من أكتوبر ????، ترأَّسَتِ الهيئةَ شيرلي هاريسون، التي ترأس أيضًا هيئةَ الأنسجة البشرية، ويبدو أن هناك نيةً إلى دمج المؤسستين معًا في الهيئة التنظيمية للأنسجة والأجِنَّة. وفي سبتمبر ????، حكمت هيئة الخصوبة البشرية وعلم الأجِنَّة بأن أبحاث الأجِنَّة المهجَّنة المندمجة من سلالاتٍ مختلفة، بما في ذلك السلالة البشرية، يمكن السماح بها بحسب كل حالة. وفي بيانٍ نُشِر تأييدًا لهذا القرار، قالتِ الهيئةُ إنه «لا يوجد سبب جوهري يمنع أبحاثَ التهجين السيتوبلازمي.» ومع هذا، لم ينطوِ هذا القرارُ على موافقةٍ محدَّدة للتطبيقين الموقوفين للسماح بمثل هذه الأبحاث. وكان من المفترَض أن تحكم الهيئةُ بشأن حالات محدَّدة في نوفمبر ????.
قراءات إضافية

www.hfea.gov.uk.

الفصل الثالث عشر
قصة نجاح كُوبيَّة


في أبريل من عام ????، زرتُ كوبا لأول مرة، ونظَّم صديقي الكوبي رينالدو فيلالونجا عدةَ اجتماعاتٍ مع العلماء في جامعتَيْ ماتانزاس وهافانا. وكان أحد الباحثين الذين تحدَّثتُ إليهم هو فيسينتي فيريز بينكومو الذي أخبرني بقصة المقال التالي الذي كان حديثَ الصحف في ذلك الوقت، ثم ظهر بعد ذلك بشهر في مجلة «ساينس».
يتم عادةً تطعيمُ الأطفال في بريطانيا لوقايتهم من «الإنفلونزا المستدمية من الفئة بي»، التي تسبِّب التهاب السحايا والالتهاب الرئوي، ولكن في العالم النامي يوجد المليارات — حرفيًّا — ممَّنْ لا تستطيع عائلاتهم تحمُّلَ تكلفة اللقاح؛ ونتيجةً لذلك، فإن أكثر من نصف مليون طفل يموتون من عدوى الإنفلونزا المستدمية كل عام. وفي عام ????، قدَّمَ الباحثون الكوبيون لقاحًا جديدًا مُخلَّقًا بالكامل يمكن إنتاجه بتكلفة أقل، وبالتالي يصل إلى جميع دول العالم. ويُعتبَر في الوقت نفسه أول لقاح مُخلَّق بالكامل ينجح في جميع التجارب السريرية.
على مدار العقدين الماضيين، استجابَتْ كوبا لنقص العقاقير الزهيدة التكلفة بالاستثمار المكثَّف في التكنولوجيا الحيوية. وكجزءٍ من هذا المجهود، شرع معمل فيسينتي فيريز بينكومو بجامعة هافانا في إنتاج بديل للقاح الإنفلونزا المستدمية الأصلي، الذي يصفه فيريز بأنه «مجرد حلٍّ للدول الثرية». وكانت التحدِّيات الرئيسية تكمن في إنتاج السكريات القليلة التعدُّد المميَّزة الموجودة على سطح خلية الكائن المُمرِض، وفي إيجاد طريقةٍ لتقديمها إلى الجهاز المناعي بحيث تحقِّق تحصينًا قويًّا ومحدَّدًا ودائمًا، بمعنى وجود أجسام مضادة تستطيع أن تبذل مجهودًا دفاعيًّا سريعًا في حالة ظهور الكائن المُمرِض الأصلي.
بالتعاون مع عالِم الكيمياء الكندي رينيه روي وآخَرين من عددٍ من مراكز البحوث التكنولوجية الحيوية الرئيسية في كوبا، الموجودة في الضواحي الغربية لهافانا (بما في ذلك مركز الهندسة الوراثية والتكنولوجيا الحيوية)، طوَّرَ فريق فيريز مسارًا مُخلَّقًا جديدًا للسكريات القليلة التعدُّد، بحيث يصلح إنتاجُه على نطاق واسع. ومع نهاية تسعينيات القرن العشرين، استطاعوا إنتاجَ السكريات، ودمجَها مع بروتين مصل بشري، وإثباتَ أنها حفَّزَتِ الاستجابةَ المناعية المطلوبة. ومع هذا، كان على الباحثين دمج السكريات مع بروتينٍ يحفِّز الجهاز المناعي بكفاءةٍ أكثر؛ لكي ينافسوا الأثرَ الممتدَّ المفعول للقاح الحالي، وقد اتضح أن بروتين ذوفان التيتانوس هو الجزيء المناسب لأداء هذا الدور.
خضعت البروتينات السكرية المُخلَّقة لجميع اختبارات السُّميَّة والتجارب السريرية، وكان أداؤها بنفس كفاءة اللقاح التجاري على الأقل. يقول فيريز: «لقد نقلنا الإنتاجَ إلى شركات التكنولوجيا الحيوية الكوبية، وسوف تُنتِج تلك الشركات مليونَ جرعة بنهاية هذا العام.»
(????)
أحدث التطورات

في نوفمبر ????، نشرت منظمة الصحة العالمية ورقةَ تحديدِ موقفٍ بخصوص التطعيم ضد الإنفلونزا المستدمية، تعلن فيها الآتي: «في ضوء إثبات لقاحات الإنفلونزا المستدمية لأمانها وفاعليتها، فإنه يجب ضمُّها إلى جميع البرامج الروتينية لتطعيم حديثي الولادة، ويجب ألَّا يُؤخِّر نقصُ بيانات المراقبة المحلية من طرح اللقاح، لا سيَّما في الدول التي يشير الدليل الإقليمي إلى ارتفاع نسبة الإصابة فيها بالمرض.»
في سبتمبر ????، طرحَتِ الهندُ لقاحًا مماثلًا طوَّرته شركة بهارات بيوتيك المحلية للتكنولوجيا الحيوية.
قراءات إضافية

V. Verez-Bencomo et al. Science, 2004, 305, 522.
http://www.myhero.com/myhero/hero.asp?hero=Hib_Vaccine_Tech_2005.

الفصل الرابع عشر
الطيور والنحل وخُلد الماء


إنني عادةً ما أقترحُ عنوانًا مع كل مقال أكتبه، ولكن يبدو أن للمحرِّرين رأيًا آخَر، وبالتالي فإن أقل من نصف عناويني المقترَحة يصمد في النُّسَخ المطبوعة. هذا أحد العناوين التي نجَتْ، وهو عنواني المفضَّل على الإطلاق. ولكن المقال مثير أيضًا.
ما الاختلاف الجزيئي المسئول عن كوننا ذكورًا أو إناثًا؟ إن الأمر يبدو بسيطًا للوهلة الأولى؛ فالذكر يملك الكروموسوم «واي» (المتدني نوعًا ما، انظر مقال «الكروموسوم الذكري مهدَّد بالانقراض») بدلًا من الكروموسوم «إكس» الثاني. وبعبارة أدق: فإن وجود جين واحد في الكروموسوم «واي»، والمعروف باسم «إس آر واي» SRY، هو المسئول عن تكوُّن الخصائص الذكورية، وفي حالة غيابه يتجه النمو إلى الخيار التلقائي، وهو الأنثى. وتزداد الأمور تعقيدًا حين يبدأ علماءُ الأحياء في التحدُّث عن الطيور والنحل؛ ففي حالة الطيور — كما تعرفون — يحدث العكس؛ بمعنى أن الإناث تحمل زوجًا من الكروموسومات الجنسية المختلفة، في حين يملك الذكور زوجًا متطابقًا. إلا أن الحيوان المُحطِّم للأرقام القياسية نظرًا لامتلاكه أكثر أنظمةِ تحديدِ الجنس حيرةً، هو بلا شك خُلد الماء. بعد سنوات من الشك، أثبَتَ الباحثون الأستراليون أن هذا الحيوان يملك ما لا يقل عن خمسة أزواج من الكروموسومات الجنسية، بما في ذلك كروموسوم مشابه لكروموسوماتنا، وآخَر أكثر شبهًا بكروموسومات الطيور. •••

إنَّ حيوان خُلد الماء المشهور هو واحد من ثلاث سلالات فقط ناجية من أعمق فروع التطوُّر البيولوجي للثدييات، أَلَا وهي الثدييات الوحيدة المسلك؛ ولهذا يُعتبَر تحديد جنسه مثارَ اهتمام، ليس فقط من باب الفضول، ولكن أيضًا بحثًا عن أيِّ ضوءٍ قد يُلقِيه على التطوُّر البيولوجي المبكِّر الذي خضع له أسلافنا من الثدييات. باستخدام تقنية التهجين «في موقع» مُفلوَر، صنَّفَ فريق فرانك جروتسنر من الجامعة القومية الأسترالية في كانبرا الكروموسوماتِ الجنسيةَ العشرة لخلد الماء، المعتادة بصورة محيِّرة على الاندماج في سلسلةٍ واحدةٍ كبيرة خلال الانقسام الخلوي؛ فاكتشفوا أن هناك خمسة كروموسومات ذكرية (واي) يمكن أن تتَّحِد مع خمسة كروموسومات إكس مختلفة، وهي دائمًا ما توجد بنفس الترتيب في السلسلة. ويوجد في أحد طرفَي السلسلة زوجٌ يشبه زوج إكس واي الموجود لدينا (مع أنه يفتقر إلى جين «إس آر واي» على نحوٍ يثير الحيرة)، إلا أن الزوج الموجود في الطرف الآخَر يعكس تشابُهًا مع الكروموسومين «زد دبليو» ZW في الطيور، حتى إن الباحثين يشكُّون في أن الزوجَ الثاني كان أول ما أنتج اختلافًا محدِّدًا للجنس، في حين عيَّنت الأزواج الأخرى اختلافًا فيما بعدُ، وجاء الزوج الذي يشبه كروموسوماتنا في النهاية. شكل ??-?: يعيش خُلد الماء في المناطق الساحلية الشرقية بأستراليا. وبما أن أسلافه التطورية قد انفصلت مبكرًا عن الفرع الرئيسي لتطوُّر الثدييات، فيمكنه أن يقدِّم معلوماتٍ مهمةً عن تطوُّر صفات ثديية معيَّنة، مثل نظام تحديد الجنس الذي نصفه هنا.
هذه السمة الموجودة في هذا الحيوان الثديي الذي يضع بيضًا ويتمتَّع بفم يشبه منقارَ البطة، هذه السمة المماثِلة على نحوٍ مدهش لما في الطيور، قد تهدم المُعتقَد القديم بأن الكروموسومات الجنسية قد تطوَّرَتْ على نحوٍ منفصل في الطيور والثدييات. وربما نكون قد ورثنا في الأصل المنظومةَ التي لا تزال موجودةً في الطيور وطوَّرناها بما يناسبنا، وربما تكون حيوانات خُلد الماء قد حافظَتْ على الحالة الانتقالية لهذا التغيُّر التطوُّري المهم.
(????)
أحدث التطورات

أخجل من أن أعترِف بأنني لم أتابِع الحياةَ الجنسية لخُلد الماء عن كثب مثلما كان يجب أن أفعل؛ ولهذا لا أعرف حقًّا أحدث التطورات في هذا الشأن بعد ذلك. وأنوي متابعةَ هذا الأمر في العام الجديد.
قراءات إضافية

F. Grutzner et al., Natüre, 2004, 432, 913.

الفصل الخامس عشر
أبناء عمومتنا المُشعِرون


أتعجَّبُ من سبب الاستشهاد دائمًا بالشمبانزي الشائع بصفته أقرب الكائنات الحية شبهًا بنا! إذا أردنا الدقة، فالشمبانزي القزم المهووس بالجنس — قرد البونوبو — يُعتبَر الأقربَ إلينا. ولكن بالنظر إلى السلوكيات المتزمتة المنتشرة في بعض مناطق العالم التي يمكن أن تخطر ببالي، فليس من الغريب أن يُنظَر غالبًا إلى الشمبانزي الشائع الحسَنِ السيرة باعتباره الأقرب شبهًا بنا، وأن يتم تحديد تسلسله الجينومي أولًا. ومن ثَمَّ، فالمقال التالي ليس مثيرًا بالمعنى الحرفي للكلمة مثلما كان يمكن أن يكون، ولكنه يظل ملائمًا لهذا القسم …
أراد أسقف أكسفورد توضيحَ مسألة العلاقات العائلية على نحوٍ حاسم. وخلال الاجتماع المشهور للجمعية البريطانية لتقدُّم العلوم الذي انعقَدَ في متحف الجامعة الحديثِ البناءِ في أكسفورد، طرح صامويل ويلبرفورس سؤالًا على توماس هكسلي حول إن كان انحدَرَ من سلالة القرود من جانب جدِّه الكبير أم جدِّته الكبيرة، فأعلن هكسلي أنه يفضِّل أن يكون جدُّه الكبير قردًا عن أن يكون إنسانًا مثل ويلبرفورس. هذا على الأقل ما تخبرنا به الروايات الواردة عن هذه الحادثة. يميل المؤرخون المُفسِدون للبهجة إلى الإشارة إلى أن جميع أوصاف هذه المجادلة جاءت من مؤيدي هكسلي، وبالتالي فإن «النصر» المفترض للمعسكر الجديد المؤيِّد للتطور البيولوجي عزَّزه ناقِلو الخبر.
بعد قرابة قرن ونصف، يستطيع العلماء تناوُل هذه المسائل بهدوء وبالتفصيل باستخدام التسلسل الجينومي؛ وبالتالي نستطيع أن نُقِرَّ بقدرٍ من الثقة أن آخِر سلف مشترك يربط بين توماس هكسلي وكلينت، الذي هو أول شمبانزي يتم تحديد تسلسله الجينومي بالكامل، لا بد أنه قد عاش منذ خمسة ملايين سنة ماضية.
إذا وضعنا أشجار العائلة جانبًا، فإن جينوم الشمبانزي مفيد للغاية؛ لأنه يمثِّل بصفة أساسية مقارَنةً مساعِدة ونقطة مرجعية في دراسات عن السلالة التي أطلق عليها جارد دايموند «الشمبانزي الثالث»، وأعني بها «الكائنات العاقلة».
على سبيل المثال، يقدِّم الحمض النووي الخاص بالقرود معلوماتٍ حول تطوُّر جينومنا خلال الخمسة الملايين سنة الماضية، وحول تطوُّر جينات معينة والضغوط الانتقائية التي وجَّهَتْها. والأمر المثير للجدل أن أهم دور لجينوم الشمبانزي يتمثَّل في اعتباره مرجعًا خارجيًّا لدراسات التنوع الإنساني، وبصفة محدَّدة فيما يتعلَّق بالاستجابات المختلفة للأمراض والعقاقير (علم الوراثة الدوائي).
شجرة العائلة

دعونا نبدأ بمسألة شجرة العائلة لكي نُخرِج هذه الأسئلة المحيِّرة من بالنا. في عام ????، استنتج موريس جودمان وزملاؤه — استنادًا إلى المعلومات الجينومية الجزئية المأخوذة من الشمبانزي وغيره من الرئيسيات — أن جنس «الهومو» (الذي يفصلنا نحن والكائنات البشرية المنقرضة مثل النياندرتال عن حيوانات الشمبانزي) ليس له دليل في علم الوراثة؛ فالتقسيم التقليدي الذي يرجع إلى عام ????، الذي جعل الشمبانزي أقربَ شبهًا بالغوريلا منه بالإنسان، قد دحضته أبحاث الجينوم. وبالتالي، اقترح جودمان توسيعَ جنس «الهومو» ليضمَّ كلًّا من الشمبانزي الشائع «بان تروجلودايتس» والبونوبو «بان بانيسكس».
في عام ????، نشر اتحاد التحليل والتسلسل النووي للشمبانزي مسوَّدَةً كاملة بنسبة ??? لجينوم الشمبانزي ومقارنة تمهيدية أولى مع الجينوم البشري؛ ليضيف بذلك المزيدَ من الأدلة التي تدعم صلة القرابة الشديدة. وبالنظر إلى الاختلافات الموجودة بين قواعد (حروف) محدَّدة للحمض النووي، اكتشف الباحثون أن ????? منها تختلف بين البشر والشمبانزي. ومع هذا، يرجع ??/?? منها تقريبًا إلى التنوُّع الطبيعي في كلِّ سلالة؛ مما يخلِّف ????? تقريبًا فقط من الاختلافات الحقيقية.
يشير هذا الرقم إلى ??? مليار قاعدة حمض نووي للشمبانزي استطاع الباحثون موازاتها (وضعها جنبًا إلى جنب لمقارنتها) مع الحمض النووي المقابل في جينوم الإنسان؛ وبالتالي تحتوي هذه المادة على حوالي ???? مليونَ اختلافٍ ضئيل بيننا وبين أبناء عمومتنا. توجد في الجينوم البشري حوالي ? ملايين قاعدة تختلف من فرد لآخَر (ويشار إليها باسم التغيُّرات الفردية المتعدِّدة الأشكال للنيوكليوتيدة). وخلال التحليل الأولي، اكتشف الباحثون ???? مليون تغيُّر فردي متعدِّد الأشكال للنيوكليوتيدة في جينوم الشمبانزي.
لم تكن عمليات إحلال حروف بعينها هي الاختلافات الجينية الوحيدة التي فصلتنا عن الشمبانزي على مدار ملايين السنين؛ إذ يوجد قبل ذلك أيضًا عدد صغير من الإدخالات والمحذوفات لمقاطع أطول من الحمض النووي، معروفة إجمالًا باسم مقاطع «إدراج/حذف»، بالإضافة إلى إعادة الترتيب. قدَّرَ باحثو الجينوم أن خمسة ملايين مقطع إدراج/حذف قد أمَدَّتْ كلًّا من السلالتين بحوالي ?? إلى ?? مليونَ قاعدة غير موجودة في السلالة الثانية. وبصورة إجمالية، تبلغ الأنواع المتباينة من الاختلافات حوالي ?? من الانحراف الجيني بين الشمبانزي والإنسان، لكن إذا كنتَ تنتمي إلى المدرسة الفكرية «المتفائلة»، فيمكنك بدلًا من ذلك أن تقول إننا نتطابَقُ وراثيًّا بنسبة ??? مع أبناء عمومتنا المُشعِرين.
ولكن هل يجب أن تكون درجة التشابه العالية هذه مبررًا لنا لكي نأكل الموز أو نتصرف كالحيوانات؟ أثبت علم الجينوم المقارن في جوانب أخرى من مملكة الحيوان أن نسبة التطابق مؤشِّر مفيد للتاريخ التطوُّري، ولكنها ليست بالضرورة مقياسًا للتشابه بين السلالات.
يستعين دارسو القرود بمثال سلالتَي الفئران المختلفتين وراثيًّا تمامًا كاختلاف البشر عن الشمبانزي، لكنها تبدو مماثِلة تمامًا من الخارج. تمثِّل سلالات الكلاب النقيض العكسي؛ فباستخدام ????? فقط من التنوع الوراثي، يستطيع مربُّو الكلابِ إنتاجَ كلاب ذات مظاهر خارجية مختلفة على نحوٍ مذهل.
شكل ??-?: الشمبانزي الشائع (بان تروجلودايتس) والبونوبو أو الشمبانزي القزم (بان بانيسكس) هما أقرب الكائنات الحية شبهًا بنا. لقد قدَّمَتْ أبحاث جينوم الشمبانزي معلوماتٍ مهمة حول التاريخ التطوُّري والتنوُّع الوراثي الحالي لسلالتنا البشرية.
الدرس التحذيري المستفاد هنا هو أن المظاهر تعتمد على عددٍ صغير من الجينات، وهذا أيضًا هو السبب في أن مفهوم «الأعراق» البشرية لا جدوى له عمليًّا في علم الوراثة؛ فثمة تنوُّع وراثي بين الأفارقة (الذين يُفترَض أنهم جميعًا ينتمون إلى العرق الأسود) أكثر بكثيرٍ من جميع الأعراق البشرية الأخرى إجمالًا.
حتى بالنسبة إلى الخصائص الخفية التي ربما نفتخر نحن البشر بها، فإن بضعة جينات يمكن أن يكون لها تأثيرٌ مختلف. وإحدى نقاط الضعف الشهيرة هي مجموعة من البروتينات التنظيمية المعروفة باسم عوامل النَّسْخ؛ إذ إنها تتحكَّم في نَسْخ الحمض النووي إلى الحمض النووي الريبي الرسول، وبالتالي في نشاط العديد من الجينات الأخرى، وطفرةٌ واحدة في مثل هذا العامل كفيلة بكل سهولة بأن تفسد عملية الأيض، أو النمو الجنيني، أو دورة الانقسام الخلوي. على سبيل المثال، ترتبط الطفرات التي تحدث في عامل النسخ «بي ??» p53 بكثير من السرطانات البشرية. لهذا، سيكون من السذاجة أن ننسب الاختلافات الواضحة وغير الواضحة بين القرود الساكنة الأشجار وبين أولئك الذين يقودون السيارات أو يكتبون الكتبَ العلمية المشهورة؛ إلى هذا الاختلاف الذي تبلغ نسبته ??. ووحده الفهم التفصيلي لوظيفة الجينوم بأكمله في النمو الجنيني هو ما سيمكِّنُنَا من فهم الاختلاف الضئيل بين السلالات الأقرب شبهًا بنا.
مقارنة الجينات

دعونا الآن ننظر عن كثبٍ إلى الجينومات لنكتشف ما يمكن أن نتعلَّمَه من الشمبانزي وغيره من الحيوانات بخصوص جيناتنا. انتقى الفريق الذي حلَّل جينوم الشمبانزي ????? جينًا يمكن مقارنتها مباشرةً بين البشر والشمبانزي. كما حدَّدَ الباحثون أيضًا مجموعةً أصغر مكوَّنة من ???? جينًا يمكن مقارنتها بين البشر والشمبانزي والجرذان والفئران.
ولكي يحدِّد الباحثون السرعةَ التي يتم بها انتقاء الطفرات المفيدة وقمع الطفرات الضارة، فإنهم في العادة يقارِنون بين معدل التبادلات القاعدية التي تؤدِّي إلى حدوث اختلاف في الحمض الأميني الذي يتمُّ التشفير له، وبين تلك التي لا تؤدِّي إلى حدوث هذا (كما هو الحال غالبًا بالنسبة إلى القاعدة الثالثة في كودون مكوَّن من ثلاثة حروف). وتتمثل الفكرة في أن التغيرات القاعدية المرادفة أو «الصامتة» من المفترض أنها تشير إلى معدل الطفرات الطبيعي، في حين أن الطفرات المشفَّرة عرضةٌ للانتقاء الطبيعي.
يقارِن الباحثون التكرارَ النسبي لكلا النوعين من الطفرات؛ فإذا تكرَّرتِ الطفراتُ «المشفِّرة» أكثر من الطفرات الصامتة في جين معيَّن أو منطقة معينة، فإن هذا يشير إلى أن الانتقاء الطبيعي قد مالَ لصالح صفات معينة. وفي الحالة المعاكِسة، يكون الانتقاء الطبيعي مشغولًا بالحفاظ على سلامة الجين وحمايته من الطفرات الضارة.
بتطبيق هذا النوع من التحليل على الجينوم البشري كلِّه بالمقارَنة مع السلف المشترك بين البشر والشمبانزي، اكتشف الباحثون أن الطفرات غير الصامتة تقل بنسبة ??? مقارَنةً بالطفرات الصامتة؛ وبالتالي كان قرابة ثلاثة أرباع الطفرات غير الصامتة ضارة بما يكفي لأن يقمعها الانتقاء الطبيعي.
ومع هذا، استطاعت بعض الطفرات الضارة، المعروفة الآن بالاختلالات الوراثية، توطيدَ نفسها. وبناءً على المقارنات الجينومية، قدَّر الباحثون أن ربع الطفرات غير الصامتة التي استطاعت الصمودَ تتَّسِم ببعض الآثار السلبية. (قد يرجع صمودها إلى تأثيرها الذي يظهر في مرحلةٍ لاحقة من الحياة، أو إلى الآثار الجانبية الإيجابية التي تفيد حاملي الطفرة؛ كما في مثال فقر الدم المِنجلي الذي يَرِد في الكتب الأكاديمية الكلاسيكية.)
أثبتَتِ المقارنةُ الجينومية الرباعية التي تضمَّنت أيضًا الجرذانَ والفئرانَ أن القوارضَ قد مرَّتْ بضغطٍ انتقائي أكثر بكثير من الرئيسيات.
أصداء ذلك في علم الوراثة السكَّانية

إنَّ المعلومات التي أُتِيحت عن جينوم الشمبانزي تفيد أيضًا مجالًا بحثيًّا لا علاقةَ له مطلقًا بالقردة أو أية سلالة حيوانية أخرى، أَلَا وهو علم الوراثة السكَّانية. بعد فكِّ شفرة الجينوم البشري، بدأ الباحثون في تناوُلِ الاختلافات بين الأفراد وبين الجماعات العِرقية، ويكمن الحافز الرئيسي وراء هذا في حقيقةِ أن فاعليةَ الأدوية والقدرةَ على تحمُّلها تعتمدان غالبًا على التركيب الوراثي لكلِّ مريض على حدة. وعلم الوراثة الدوائي هو منهج علمي يهدف إلى التنبُّؤ بالعقَّار الذي سيفيد كل مريض على حدة.
أثمرَتْ هذه المجهودات بالفعل عن تحديدِ أكثر من سبعة ملايين تغيُّرٍ فردي متعدِّد الأشكال للنيوكليوتيدة (تغيُّرات أحادية الحرف). ومع هذا، فاكتشافُنا أن ثمة اختلافاتٍ بين الأفراد لا يكشف لنا عن كيفية حدوثها؛ أيُّها النسخة «الأصلية» وأيُّها الطفرة؟ وكيف انتشرَتِ الطفرةُ؟ لا يمكن الإجابة عن مثل هذه الأسئلة بواسطة الجينوم البشري وحده، وإنما أيضًا بواسطة جينوم الشمبانزي كنقطة مرجعية.
بمساعدة جينوم الشمبانزي كلينت، استطاع الباحثون بالفعل توضيحَ أصول ??? من التغيُّرات الفردية المتعدِّدة الأشكال للنيوكليوتيدة في البشر. وفي الحالات التي لا تزال غامضةً (إذ ربما تكون قاعدة الشمبانزي متغيِّرة أو مختلفة عن النُّسَخ البشرية)، فمن المأمول أن يوضِّح المزيدُ من جينومات الرئيسيات تلك الأمورَ.
(????)
أحدث التطورات

حتى عام ????، ظلَّ الباحثون مشغولين بسدِّ الثغرات الأخيرة في جينوم الشمبانزي؛ ليحدِّدوا الجينات والوظائف التي تقوم بها. يمكنك مشاهدة ما يتم إنجازه في هذا الشأن على الموقع الإلكتروني: http://www.ncbi.nlm.nih.gov/genome/guide/chimp/ في محاولةٍ لتحسين فهمنا لجينومنا البشري بمساعدة السلالات الشبيهة، ويُعتبَر تحديدُ التسلسل النووي المستمر لإنسان النياندرتال (انظر مقال «كشف أسرار إنسان النياندرتال») على القدر نفسه من الأهمية بالنسبة إلى مشروع الشمبانزي. قراءات إضافية

The Chimpanzee Sequencing and Analysis Consortium, Nature 2005, 437, 69–87.
(free access via Nature’s web focus: http://www.nature.com/nature/focus/chimpgenome/index.html).

الفصل السادس عشر
كيمياء كيوبيد


في فبراير ????، اشتهرتُ لمدة يوم، وكان لي ظهور إعلامي في أرجاء المعمورة، وكل هذا بسبب بيانٍ صحفي أصدرَتْه الجمعية الملكية للكيمياء قبل عيد الحب، بناءً على المقال التالي. ولكن على الرغم من هذا يجب أن أقول إنني كنتُ مسرورًا عندما انتهى عيد الحب وتوقَّفَتِ المحطات الإذاعية عن الاتصال بي.
قد يكون كيوبيد، رامي السهام الصغير اللعوب، في كل مكان حولنا في ذلك الوقت من العام، ولكن لا توجد أدلة علمية كثيرة تؤيِّد الادِّعَاء القديم بأن سِهامَه تجعل الناس تقع في الحب، كما أن تفسيرَ أفلاطون البديع الذي ينطوي على خسارة «النصف الآخَر» لن يصمد أمام آراء فلاسفة اليوم. وإذا حاوَلَ أي شخص أن يبيعك ترياقًا للحب على طريقة تريستان وإيزولده، يجب ألَّا تتوقَّع أيَّ معجزات منه.
على الرغم من فشل التفسيرات الرومانسية، تستمر الظاهرة الرومانسية، وطبقًا للباحثة هيلين فيشر المتخصِّصة في علاقات الحب، فهذه الظاهرة «ثابت ثقافي عالمي أو شبه عالمي». فهي تزعم أنه ما من ثقافة إنسانية على وجه الأرض ثبت عدمُ معرفتها بظاهرة الحب الرومانسي.
يجادِل العلماء بأنها إن كانت عالميةً، فلا بد أن لها أساسًا بيولوجيًّا، بعبارة أخرى: لا يمكن أن تكون مجرد عادةٍ ثقافية مثل الكريكيت أو الأوبرا. وفي السنوات الأخيرة، تخلَّى بعض العلماء بكل جرأةٍ عن خوفهم الطبيعي من الجانب اللاعقلاني للكائن البشري، وشرعوا في دراسة العمليات البيولوجية والكيميائية الكامنة وراء الحب الرومانسي، ودرسوا على وجه التحديد حركةَ الجينات والخلايا العصبية والرُّسُل الكيميائية مثل الهرمونات والفيرومونات.
شكل ??-?: لوحة زيتية لإله الحب كيوبيد بريشة ويليام أدولف بوجيرو (????–????).
قصة فأر الحقل

بطبيعة الحال، لو كان نوعٌ ما من الظواهر البيولوجية موجودًا عبر سلالةٍ بأكملها على مستوى العالم، فسيشك المرء في أنه مدموغ في الجينات بشكل أو صورة ما. مشكلةُ الحبِّ أنه ظاهرة معقَّدة، تتحكم فيه على ما يبدو تفاعلاتٌ معقَّدة بين العديد من النواتج الجينية المختلفة؛ وبناء عليه ستكون دراسته صعبةً، لنفس الأسباب التي تنطبق على الأمراض المتعدِّدة العوامل مثل مرض القلب. وعلاوة على ذلك، فإن المشكلة مع البشر هي أن القضايا الأخلاقية تمنع أيَّ تلاعُبٍ بجيناتهم، وهو ما سيكون مطلوبًا لفكِّ تفاعلاتِ العديد من الجينات.
لهذا، بقيَتِ الدراساتُ الجينية للتزاوج والمغازَلة قاصرةً حتى الآن على الحيوانات، وفي مسائل بسيطة نسبيًّا. وقد أُجرِيت أروعُ دراسة من هذا النوع وأكثرها انتشارًا على سلالتين من فئران الحقول في أمريكا الشمالية، وتحديدًا فأر البراري الأحادي الزوج «مايكروتيس أوركوجاستر»، وفأر الحقول الجبلي «مايكروتيس مونتانوس» الشبيه به جينيًّا، ولا يكوِّن أيَّ ارتباطٍ ولكنه يتزاوج عشوائيًّا. اكتشف توماس إنسيل ولاري يونج من جامعة إيموري في مدينة أتلانتا بولاية جورجيا، غرزًا في جينٍ لفأر البراري الأحادي الزوج الذي يُظَنُّ أنه غير موجود في فأر الحقول الجبلي المتعدد الزوجات.
ليختبر الباحثون إن كان هذا الغرز مرتبطًا بالاختلاف في السلوك الجنسي أم لا، دمجوا الجين المتضمن للغرز في جينوم ذكور فئران الحقول الجبلية. وفي واقع الأمر، نجحوا في «علاج» هذه القوارض من الاختلاط الجنسي العشوائي بهذا التلاعُب الجيني البسيط.
ومؤخرًا، تمَّ تعقُّبُ «جينٍ جنسيٍّ» آخَر في ذبابة الفاكهة «دروسوفيلا». أوضح كين إتشي كيمورا وزملاؤه في جامعة هوكايدو أن البروتينَ الذي يشفِّر لإنتاجه الجين «غير المثمِر» في الدروسوفيلا يتحكَّم في بناء دائرة عصبية خاصة بالذكور يُعتقَد أنها تلعب دورًا رئيسيًّا في سلوك المغازَلة الذكري، وهو ما يحوِّل انتباهَنا من الجينات إلى الخلايا العصبية والمخ.
بصدق وجنون وعمق

تقنيات تصوير المخ الحديثة — مثل التصوير بالرنين المغناطيسي الوظيفي أو المسح المغناطيسي المتعلِّق برسم الدماغ — ليسَتْ مجرد أداةٍ عادية من أدوات التصوير؛ فقد نجحت في كشف النقاب عن عالَمٍ جديد من الاحتمالات؛ لأنها تمكِّن الباحثين من ملاحظة المخ خلال عمله دون الإضرار بالمريض.
اشتركَتْ هيلين فيشر، عالِمة الأنثروبولوجيا في جامعة روتجرز، مع الباحثَيْن آرثر أرون ولوسي براون من نيويورك ليدرسوا كيفيةَ ظهور الحب الرومانسي في مراحله الأولى بالمخ. وبصفة أساسية، شرعوا في تحديد إن كان الحب يعمل مثله مثل أي شعور أساسي (كالخوف مثلًا)، أو إن كان ينتج عن حلقات التغذية الراجعة لمنظومة المكافأة الموجودة بالمخ (مثل إدمان الكوكايين).
استعان الباحثون بعَشْر نساء وسبعة رجال قالوا إنهم واقعين في الحب بشدةٍ منذ ما يتراوح بين شهر وسبعة عشر شهرًا، وقيَّموهم من خلال المقابلات قبل إخضاعهم للتصوير بالرنين المغناطيسي الوظيفي وبعده. وخلال تجربة التصوير، عُرِضت على كلِّ مشارِكٍ صورةُ محبوبه وطُلِب منه استرجاعُ أي ذكريات عزيزة مرتبطة بهذا الشخص. وكنوع من الضوابط السلبية للتجربة، عُرِضت عليهم أيضًا صورُ أصدقاء آخَرين وأفراد أسرتهم وسُئِلوا نفسَ السؤال. وللتخلُّص من أيِّ مشاعر رومانسية فيما بين الصور، طُلِب من المتطوِّعين إجراءُ عملية حسابية عقلية، وهي العدُّ عكسيًّا بدءًا من عددٍ معيَّن مكوَّن من أربعة أرقام يتمُّ اختياره عشوائيًّا مع طرح سبعة أرقام في كل مرة. (جرِّبْ هذا الإجراءَ إذا أردتَ أن تصفِّي ذهنَك من العبء العاطفي؛ إذ يبدو أنه كان فعَّالًا في أقل من دقيقة!)
قارَنَ الباحثون بين صور المخ الخاصة بمتطوِّعيهم الغارقين في الذكريات الرومانسية، وتلك المرتبطة بالصور المحايدة، وتلك التي تمَّ جمعها خلال التمرين الحسابي العقلي، فاستطاعوا أن يحدِّدوا عدةَ مناطق رئيسية في الدماغ تشترك فيما يبدو في المشاعر الرومانسية القوية، ولكنها لا تشترك في التعرُّف على الوجوه، مثلًا. وعلى وجه الخصوص، سجَّلوا نشاطًا في المخ الأوسط الجوفي الأيمن، حول ما يُطلَق عليها اسم المنطقة السقيفية الجوفية والجسم الظهري المذنب والذيل المذنب. جميع هذه المناطق غير مرتبطة بالمشاعر والغرائز البدائية مثل الخوف، ولكنها مرتبطة بمنظومة المكافأة التي بوسعها أن تجعلنا ندمن المخدرات.
استنتج كلٌّ من فيشر وأرون وبراون بعد مراجعة أبحاثهم بالمقارَنة مع أبحاث مماثلة؛ أن «الحب الرومانسي هو منظومةُ مكافآتٍ في المقام الأول، ويقود إلى العديدِ من المشاعر، وليس إلى شعور محدَّدٍ». وبصفة خاصة، لا يوجد تعبير وجهي يمكن ربطه على نحوٍ قاطِع بالوقوع في الحب، كما لاحظوا أيضًا أن الحب الرومانسي العنيف في مراحله الأولى يختلف عن كلٍّ من الإثارة الجنسية ونشأة التعلُّق في المراحل التالية من العلاقة، وهو ما ينشِّط مناطقَ مختلفة من المخ.
في دراسةٍ لاحقة، بدأَتْ فيشر وزملاؤها النظر إلى ما يحدث عندما تفشل علاقةُ الحب، فتقول فيشر: «جميعنا يتعرَّض للهجر في مرحلةٍ أو أخرى، ولهذا أردْتُ أن أرى ما يحدث في المخ عندما يتعرَّض المرءُ للهجر في علاقة الحب.» وبناءً على هذا، استخدمَتْ هي وزملاؤها تقنيةَ تصويرِ الدماغ على مجموعة مكوَّنة من ?? متطوِّعًا تعرَّضوا للهجر مؤخرًا. وحسب النتائج المبدئية، توصَّلَتْ فيشر إلى أن «ثمة أمورً كثيرة تحدث في المخ عندما تنظر إلى صورةِ شخصٍ تخلَّى عنك لتوِّه، بما في ذلك حدوث نشاطٍ في مناطق المخ المرتبطة بالألم الجسماني، وسلوكيات الوسواس القهري، والتحكُّم في الغضب، وفي مناطق نستخدمها عندما نحاول التكهُّن بما يفكِّر فيه شخص آخَر.» وبدلًا من أن تتعطَّلَ أنشطةُ المخ المرتبطة بالنعيم الرومانسي السابق، وجدَتْ فيشر أنه «يبدو أيضًا أنك عندما تتعرَّض للهجر، يزداد تعلُّقُكَ بشريككَ الذي هجرك، وتبدأ في الوقوع أكثر في غرامه.»
إنَّ السمة الرئيسية في مناطق المخ التي ربطها الباحثون الأمريكيون بالحب الرومانسي هي أنها تشترك في مسارات إرسال الإشارات باستخدام هرمون الدوبامين. ولكن ما هي الهرمونات الأخرى التي يمكن أن نلومَها على التقلُّبات العاطفية للحب الرومانسي؟
جزيئات الحب

دوناتيلا مارازيتي هي طبيبة نفسية بجامعة بيزا، بدأَتْ دراسة التغيُّرات الهرمونية المرتبطة باضطراب الوسواس القهري، ثم انتقلَتْ إلى تلك التغيُّرات التي تحدث عندما يقع المرء في الحب. في البداية، اكتشفَتْ هي وزملاؤها تراجُعًا في وظيفة ناقلاتِ السيروتونين في دمِ المتطوِّعين الواقعين في الحب، الذين تمَّ اختيارُهم وتصنيفُهم على «مقياس الحب الشديد» على غرار المتطوِّعين الذين شاركوا في الدراسات الأمريكية المذكورة أعلاه. ومثل مرضى الوسواس القهري، فإن المتطوِّعين الغارقين في الحب أظهروا تركيزًا منخفضًا من السيروتونين في الدم، وهو ما قد يفسِّر سببَ تحوُّلِ المرحلة الأولى من الحب الرومانسي إلى هوسٍ.
في أحدث الدراسات التي أجرَتْها مارازيتي بالتعاون مع دومينيكو كانال، قامَا بتوسيع دائرة البحث للتحقُّق من حدوث تغيُّراتٍ في تركيز عددٍ من الهرمونات، بما في ذلك الإستراديول والبروجسترون والديهيدرو إيبي أندروستيرون والأندروستنديويون، التي وُجِد أنها لم تتأثَّر بأي مشاعر رومانسية. وعلى العكس من ذلك، لاحَظَا تغيُّرات في الكورتيزول والهرمون المنشِّط لحويصلات المبيضين والتيستوسترون، وكانت بعض التغيُّرات مرتبطةً بجنس الشخص؛ فعلى سبيل المثال، لُوحِظَ حدوثُ ارتفاع في نسبة هرمون التيستوسترون لدى النساء، بينما تراجَعَ لدى الرجال عند وقوعهم في الحب.
لو أقسَمَ الأحباء أن مشاعرهم ستدوم إلى الأبد، فإن الهرمونات تصوغ بوضوحٍ قصةً مختلفة. اكتشفَتْ مارازيتي وكانال عندما عاوَدَا اختبارَ نفس المتطوِّعين بعد ??–?? شهرًا؛ أن الاختلافات الهرمونية قد اختفَتْ كليةً، حتى لو ظلت العلاقات سليمة.
باستخدام نفس الطريقة في اختيار المتطوِّعين، بحَثَ إنزو إيمانويل وزملاؤه من جامعة بافيا فيما إن كانت فئة مختلفة من الرُّسل الكيميائية، وتحديدًا النيوتروفين، تشترك في التجربة الرومانسية، وقد أعلنوا في نهاية عام ???? أن تركيزَ عامِل النموِّ العصبي في الدم يتخطَّى المستويات الطبيعية لدى المتطوِّعين الواقعين في الحب، وأنه يتزايَدُ كلما زادت قوةُ المشاعر الرومانسية، بحسب مقياس الحب الشديد. ومن غير المعلوم بعدُ في كيمياء الحب، إن كانَتْ هناك حاجة إلى مزيدٍ من عامل النمو العصبي خلال المرحلة الأولى من علاقة الحب، نظرًا لجميع التجارب الجديدة التي تُحفَر في الذهن، أو إن كانت له وظيفة ثانية؛ فإنها لا تزال أمورًا غير مستكشَفة.
اكتشف إيمانويل وزملاؤه أيضًا أنه بعد ??–?? شهرًا، اختفَتْ جميعُ جزيئات الحب، حتى مع استمرار العلاقة. ولم تكن قوةُ المشاعر المبدئية على مقياس الحب الشديد ولا تركيزُ عامل النمو العصبي مؤشِّرين مناسبين لمصير العلاقة بعد هذه الفترة.
الفينيليثامين رسول حبٍّ جزيئي آخَر، وهو ناقل عصبي مرتبط من الناحية البنيوية بالأمفيتامينات. تقول جابي فروبوس التي شاركَتْ مع زوجها رولف فروبوس في تأليف كتاب «الشهوة والحب، هل الأمر أكثر من مجرد كيمياء؟»: «الفينيليثامين مسئول عن الحب من النظرة الأولى. ولكن بعد زوال متعته الأولى التي قد تدوم ما بين عامين إلى ثلاثة، فإن تأثيره يتلاشى.»
ولكن إذا كانت جميع الرُّسُل الكيميائية الخاصة بالمشاعر الرومانسية الجياشة تختفي خلال عامين، فما الرابط الكيميائي الذي يُبقِي المتزوِّجين معًا (بعضهم على الأقل)؟
الجزيء الرئيسي الخاص بمرحلة التعلُّق هو هرمون الأوكسيتوسين، الذي هو عبارة عن ببتيد تُساعيِّ التركيب وُصِف لأول مرة بأنه الأساس الكيميائي الذي يحفِّز المخاض وإفراز اللبن، ولكن اكتُشِفت له لاحقًا وظيفةٌ ثانية باعتباره «هرمونَ العناق» البشري، وهو يرتبط بهرمون الفازوبريسين الذي يتحكَّم في وظائف الكُلى، ويشترك أيضًا في تعلُّق فئران البراري السالفة الذكر بعضها ببعض.
أثبتَتِ التجارب أن كلا الهرمونين أو أحدهما يستطيع — بحسب السلالة — أن يجعل الحيوانات تتحاضن. وفي البشر، اتضح أن إنتاج الأوكسيتوسين يرتفع خلال ذروة النشوة الجنسية لدى المرأة؛ مما يفسِّر سبب رغبتها في العناق بعد انتهاء العلاقة الجنسية. بخلاف ذلك، وبخلاف دوره في الولادة، لم يُعرَف الكثيرُ عن دور الأوكسيتوسين في فسيولوجيا الإنسان وسيكولوجيته حتى وقت قريب للغاية.
في عام ????، أعلنَتْ فِرَق عديدة تطوُّرًا في الدراسات التي أُجرِيت عن دور الأوكسيتوسين في البشر، حيث ربطَتِ الهرمونَ ببداية الاختلاط الاجتماعي والتعارف الاجتماعي والثقة. وقد أثبت مايكل كوزفيلد وزملاؤه من جامعة زيورِخ تحديدًا أن استنشاقَ الأوكسيتوسين في صورة سبراي أنفي جعلَ المشاركين في «لعبة ثقةٍ» صمَّموها بأنفسهم أكثرَ ثقةً تجاه المشاركين الآخرين، ولكن ليس تجاه الكمبيوتر. يتطابق هذا الاكتشاف مع توقُّعات الباحثين الإيطاليين، حيث تقول دوناتيلا مارازيتي التي أتمَّتْ لتوِّها دراسةً عن دور الأوكسيتوسين في الحب الرومانسي، ولكنها تحتفظ بتفاصيلها سرية: «لستُ مندهِشةً بنتائج بحث كوزفيلد.»
سهام كيوبيد

وأخيرًا، ثمة عائلةٌ أخرى من الرُّسُل الكيميائية المرتبطة بالحب — وتحديدًا الفيرومونات — لا يُعرَف عنها هي أيضًا الكثيرَ لدى البشر؛ إذ إن معظم معرفتنا قائمة على الحيوانات. وبحسب التعريف، فإن الفيرومونات موادُّ كيميائية تهدف إلى التواصل بين أفراد من نفس السلالة، ويُعتبَر استخدامها في الحشرات مقبولًا لدرجة أن «فِخاخَ الفيرومون» متاحةٌ تجاريًّا لحماية المحاصيل.
إنَّ معرفتنا عن الثدييات أقلُّ اكتمالًا، ناهيك عن البشر. يخمِّن معظم الأفراد المتعلِّمين أن الفيرومونات التي تفرزها بعضُ الغدد، على سبيل المثال بواسطة العرق، تتعرَّف عليها خلايا مستقبِلة يُفترَض أنها موجودة في ذلك الجزء الصغير من أنفنا المعروف باسم عضو جاكوبسون أو العضو الميكعي الأنفي (انظر مقال «جزيئات جاكوبسون»). ومع ذلك، لم يرصد الباحثون بعضَ مستقبِلات الفيرومون الثديية المفترضة لدى الفئران إلا في عام ????. وفي أكتوبر ????، اكتشف فريق بقيادة هيروكو كيموتو بجامعة طوكيو معلومةً مثيرةً في لُغز الفيرومون؛ فقد أوضَحَ الباحثون اليابانيون أن فيرومون الفئران غير المتطاير، الذي أطلقوا عليه إي إس بي-? (وهو ببتيد تفرزه غدة الإكسوكرين)، تُفرِزه الغددُ الدمعية في ذكر الفأر، وينشِّط الخلايا المستقبِلة — بعد الاحتكاك المباشِر — في العضو الميكعي الأنفي لدى الأنثى.
مجدَّدًا، لا يزال من غير الواضح إن كانَتْ دموع ذكر الإنسان لها نفس التأثير أم لا. في واقع الأمر، ثمة جدل دائر حول إن كان العضو الميكعي الأنفي لدى الإنسان هو في الواقع عضوًا عامِلًا من أعضائنا الفسيولوجية أو عضوًا غير نَشِط باقيًا من التطوُّر البيولوجي الذي تعرَّضَتْ له الثدييات. ويبدو الآن أن الأدلةَ ستجعل الكفة ترجح ببطء لصالح الفريق المؤيِّد لوجود العضو الميكعي الأنفي. بالنسبة إلى أيِّ عالِم كيمياء مهتَمٍّ بالأمور الرومانسية، فلا بد أنه سيسعد كثيرًا إذا استطاع إثباتَ أن الرُّسُل الكيميائية تنقل الشعورَ الرومانسي بين البشر. وفي نهاية المطاف، هذا هو الشيء الوحيد الذي يستطيع العلمُ تقديمَه بوصفه تشابهًا واقعيًّا مع سهام كيوبيد.
(????)
أحدث التطورات

لم يتناهَ إلى سمعي أيُّ تقدُّمٍ كبير في هذا الشأن، ولكن إذا وصلني أيُّ شيء، فسأضطر بالطبع أن أنتظر حتى يحينَ عيدُ الحب؛ لأن المقالات «الموسمية» ستحظى بأكبر تغطية في وسائل الإعلام.
قراءات إضافية

G. Frob?se and R. Frob?se, Lust and Love-is it more than chemistry? Royal Society of Chemistry, 2006.
H. Fisher, Why we love-the nature and chemistry of romantic love, Henry Holt, 2004.
D. Marazziti and D. Canale, Psychoneuroendocrinology, 2004, 29, 931.
K.-I. Kimura et al., Nature, 2005, 438, 229.
A. Aron et al., J. Neurophysiol., 2005, 94, 327.
H. Fisher et al., J. Comp. Neurol., 2005, 493, 58.
E. Emanuele et al., Psychoneuroendocrinology, 2005, 30, 1017.
A. B. Wismer Fries et al., Proc. Natl. Acad. Sci USA, 2005, 102, 17237.
P. Kirsch et al., J. Neurosci., 2005, 25, 11489.
M. Kosfeld et al., Nature 2005, 435, 673.
H. Kimoto et al., Nature 2005, 437, 898.

الفصل السابع عشر
كولومبيا من بعد كولومبوس


الأشخاص الأكثر جاذبية على كوكب الأرض موجودون بالطبع في أمريكا اللاتينية. لكن من غير الواضح بالضبط الطرق التي تسبَّبت من خلالها بوتقة الاختلاط الوراثي التي أعقبت «الاستعمار الإسباني للأمريكتين» في ظهور هذا المزيج من الصفات.
سكان أمريكا اللاتينية هم مزيجٌ ثري ومتنوِّع من الموروث الجيني الذي يجمع بين السكان الأصليين والأفارقة والأوروبيين. وقد سار التقدم الاقتصادي في العالم الجديد خلال الحكم الاستعماري في مسارين مختلفين بصفة أساسية؛ ففي المناطق الاستوائية وشبه الاستوائية الغنية بالموارد، استغلَّ مشرِفو العبيد الأوروبيون العمالةَ الرخيصة التي تمَّ تشغيلها بالسخرة سواء أكان محليًّا أم في أفريقيا. لكن في الأجواء المعتدلة لأمريكا الشمالية والجنوبية، طردت عائلات المستوطنين الأوروبيين السكانَ الأصليين خارج الأراضي.
كانت لهذه الأساليب المتباينة آثارٌ بالغة الاختلاف على المصير الوراثي للسكان؛ ففي حالة النموذج الاستوائي، اختلط المهاجرون والسكان الأصليون في نهاية المطاف وتمازجوا على الرغم من التعصُّب العِرقي، في حين احتفظت عائلات المستوطنين الأوروبيين في الأجواء المعتدلة بمستودعها الجيني لنفسها.
وهكذا، يتَّضِح على نحوٍ مُقنِع سببَ اختلاف شكل معظم الكنديين عن معظم المكسيكيين، ولكن حتى وقت قريب لم يكن يوجد دليل علمي دامغ يوضِّح كيفية تكوُّن هذا المدى الواسع والسلس من الوراثة المختلطة في المناطق الاستوائية وشبه الاستوائية في العالم الجديد. ولقد أسفرت المحاولات الأولى لاستخدام الطرق الوراثية في حلِّ هذه المشكلة عن نتائج متضاربة.
استعان فريق بقيادة أندريس رويز ليناريس من كلية لندن الجامعية، على سبيل المثال، بالتسلسل الجيني لدراسة أصول السكان الحاليين في منطقة أنتيوكيا في الجزء الغربي من كولومبيا (بالقرب من مدينة ميديلين)، وأشارت الدراسات الأولى إلى أن الكولومبيين القاطنين في هذه المنطقة، الذين يعتبِرون أنفسهم سكَّانًا من أصل أوروبي، هم في الواقع أوروبيون بنسبة ??? حسب كروموسومات «واي» التي يحملونها، والتي لا تنتقل إلا عبر نسب الأب. بَيْدَ أن الجينات الميتوكندرية، التي لا تنتقل إلا عبر نسب الأم، كشفت عن قصة مختلفة تمامًا؛ ففي سلالة النسب الأنثوي، كان تكوين سكَّان أنتيوكيا ممثلًا بالنسب التالية: السكان الأصليون بنسبة ???، والأفارقة بنسبة ??، والأوروبيون بنسبة ?? فقط.
انطلاقًا من اهتمام أندريس رويز ليناريس وزملائه بهذه المفارَقة الواضحة، أجروا المزيد من الدراسات التفصيلية في نفس المنطقة، وفي تحليلهم المتطوِّر، ضمُّوا أيضًا تغيُّرَ الكروموسوم «إكس»، ووفرةَ الألقاب العائلية الشائعة، التي تمَّ تحليلها من حيث ارتباطها بالصفات المميِّزة للكروموسوم «واي».
قدَّم هذا التحليل التفصيلي معلوماتٍ أعمق عن تاريخ السكان. على سبيل المثال، استطاع الباحثون أن يُثبِتوا أن خمسةً من بين أكثر الألقاب العائلية شيوعًا في المنطقة يمكن إرجاعُ أصلها إلى مهاجِر إسباني واحد جاء في منتصف القرن السابع عشر تقريبًا. ومن بين الألقاب العائلية التي كانت متوافرة منذ البداية، نجد أيضًا أريستيزابال، الذي يعرفه محبِّو موسيقى البوب/الروك اللاتينية باعتباره لقبَ المطرب خوان إيستبان أريستيزابال، أو خوانيس اختصارًا لاسمه، الذي هو في الواقع من سكان ميديلين الأصليين.
عقب وصول الآباء الإسبان المؤسِّسين، انكشفَتِ الدراما الجينية على النحو التالي؛ اختلَطَ المغامرون الأوروبيون — الذين كانوا يصلون في العادة دون زوجاتهم — بنساء السكان الأصليين (طبعًا لم تبيِّن لنا الأبحاثُ الوراثية إن كان ذلك قد تمَّ برضا أولئك النساء أم لا!) فتكوَّن بذلك أولُّ جيل من الهجناء.
ولكن في الجيل التالي، عندما ظهرت النساء المهجَّنات على الساحة، فضَّل الرجال القادمون الهجيناتِ عن نساء السكان الأصليين، وسرعان ما تراجعَتِ المساهمة الجينية للسكان الأصليين إلى الصفر تقريبًا. ويخمِّن الباحثون أن كلًّا من التراجُع الحاد في مساهمة السكان الأصليين وميول الأوروبيين (العنصرية إلى حدٍّ ما) ربما يكون قد لعِبَ دورًا في هذا النمط.
استمرَّ هذا النمطُ على مدار قرون، في انعزال نسبيٍّ، حيث يتمركز الذكور من السلالة الأوروبية (الأبوية) على قمة هرم السلطة، ويختارون (في غياب النساء الأوروبيات) أنقى الهجينات اللاتي يستطيعون إيجادهن. ويفسِّر هذا السلوكُ بوضوح السببَ في كون الكروموسومات «واي» للسكان الحاليين (إلى جانب الألقاب) أوروبيةً بصفة أساسية، في حين أن الجينات الميتوكندرية تنتمي للسكان الأصليين بصفة أساسية.
على العكس من ذلك، لم تحظَ النساء الأوروبيات بكثيرٍ من المُدخَلات الجينية؛ لأن الرجال المستعمرين كانوا يسافرون في العادة دون زوجاتهم، فخسر الآباء من السكان الأصليين فرصهم؛ لأن بناتهم كنَّ يجذبن فقط الجيلَ الأول من المهاجرين الذكور. ولا تزال الكيفية التي أدى بها هذا التقطير الجزئي للجينات إلى إنتاجِ موسيقى خوانيس قيد الدراسة.
(????)
قراءات إضافية

L. G. Carvajal-Carmona et al., Hum. Genet., 2003, 112, 534.
S. Miller and J. Diamond, Nature 2006, 441, 411.
G. Bedoya et al., Proc. Natl Acad. Sci. USA, 2006, 103, 7234.

الفصل الثامن عشر
في نخب جينوم الخمر


في الجزء الثاني من هذا الكتاب، قدَّمْتُ لكم الصوتَ، والضوءَ، والكلامَ العَذْب، والأشخاص الجذَّابين، وبالتالي فكل ما نحتاج إليه الآن هو شيءٌ لذيذ للشرب. ما رأيكم بكأس من بينو نوار، إلى جانب معلوماتٍ عن تطوُّر النبات وفوائده الصحية؟
أكمل فريق من الباحثين في فرنسا وإيطاليا مسوَّدةَ التسلسل الجينومي لكرمة العنب المعروفة علميًّا باسم «فيتيس فينيفرا»، التي تقدِّم معلوماتٍ قيِّمةً حول تطوُّرِ النباتات وحول القدرات الخاصة التي تتميَّز بها كرمة العنب لإنتاج عدة روائح وعدد من المركبات ذات الفوائد الصحية.
انتقى الباحثون نوعًا من كرمات العنب مشتقًّا من الصنف المستنبت بينو نوار، الذي تمَّ إنتاجه من أجل وجود زيجوتٍ متماثلة الألائل؛ مما يعني أنه بالنسبة إلى معظم الجينات فإن كلتا النسختين من الكروموسومات المطلوبة تحمل نفسَ النسخة من الجين. تتسم معظم صور كرمات العنب بعدد هائل للغاية من الاختلافات (يصل إلى ???) بين النسختين، وهو ما قد يجعل الطريقة المتعارَف عليها المعتمِدة على التسلسل النووي القسري صعبةً للغاية.
بواسطة هذا النوع المختار، طبَّقَ الفريق أساليبَ التسلسل الجينومي النموذجية، وحصل على أكثر من ثمانية أضعاف التغطية للجينوم بأكمله. بما أن هذا هو التسلسل الجينومي الرابع لكاسيات البذور (بعد الأرابيدوبسس، والأرز، والحَوْر)، حلَّل الباحثون تطور جينوم النبات بعمق أكبر مما كان ممكنًا في السابق. وبصفة خاصة، عرفوا الأحداث التطورية التي زاد فيها جينوم النبات بأكمله إلى ضعفين أو ثلاثة، بالإضافة إلى رصد مكانه في «شجرة عائلة» أولية لهذه السلالات الأربع.
علاوة على ذلك، كشفت أيضًا التحليلات الأولى للجينوم عن بعض الصفات التي تجعل الخمر مميَّزًا. فعلى سبيل المثال، نجد أن سينثاز الستيلبين المسئول عن تخليق الريسفيراترول، وهو عبارة عن مشتق فينول يرتبط بالفوائد الصحية للاستهلاك المعتدل للخمر، يمثِّله عدد ضخم من الجينات. وقد وجد الباحثون ?? جينًا ينتج سينثاز الستيلبين، معروف أن ?? منها على الأقل نَشِطٌ.
تعتقد آن فرانسوا أدام بلوندون، التي عملت في أحد المشاريع بوحدة أبحاث جينوم النبات في إفري جنوب باريس، أن التطبيقات العلمية لهذه النتائج سرعان ما ستتحقَّق؛ فقد علَّقت قائلة: «صار بالإمكان الآن — على سبيل المثال عن طريق مسحٍ للجينوم بأكمله بحثًا عن اختلال ارتباطي — أن نربط أنماطًا فردية محدَّدة بصفات الخمر، إلى جانب الصفات الزراعية المهمة مثل مقاومة الميكروبات.» ويمكن أن تهدف الأبحاث التطبيقية «إلى تحسين جودة مستنبتات كرمات العنب القادرة على مقاومة الأمراض، وبالتالي تساهم بقدرٍ أكبر في تقليل حاجتنا إلى العلاج بمبيدات الفطريات ومبيدات الحشرات، وفي ظهور ظروف زراعية مستدامة. وثمة مسار آخَر للتطبيق العلمي يتمثَّل أيضًا في نمو مستنبتات تُنتِج مستوياتٍ عاليةً من المركبات المنتِجَة لعصائر الفاكهة والمفيدة للصحة.»
وماذا عن الطَّعْم؟ ترتفع نسبة وجود الإنزيمات المرتبطة بالروائح في هذا الجينوم مقارَنةً بالنباتات الأخرى. سينثاز التيربين مشترِك في تفاعل النبات مع بيئته، ولكن في حالة كرمة العنب فإنه مسئول أيضًا عن الروائح. احتوت النباتات الثلاثة الأخرى التي تمَّ تحديدُ التسلسل النووي لها على ما يتراوح بين ?? و?? جينًا من أمثال هذا الجين، في حين تتباهى كرمة العنب ? ?? جينًا فعَّالًا منتجًا لسينثاز التيربين و?? جينًا زائفًا. وبالتالي، فإن التنوع الثري في الطَّعْم الذي يتميَّز به الخمر يبدو أنه راجِع أساسًا إلى جينوم كرمة العنب.
(????)
قراءات إضافية

The French-Italian Public Consortium for Grapevine Genome Characterization, Nature, 2007, 449, 463.
On resveratrol and lifespan (of mice):
J. A. Bauer et al., Nature, 2006, 444, 337.

الجزء الثالث
تكنولوجيا رائعة


التكنولوجيا هي الكلمة التي نستخدمها لوصف الأشياء التي لم تتأكَّد فاعليتها بعدُ.
دوجلاس أدامز إن كلمة «رائع» كلمة شائكة تحمل معانيَ كثيرة؛ فهي إحدى أكثر الصفات غموضًا على الإطلاق؛ حيث إن نطاق الأشياء التي تُوصَف بأنها رائعة أو غير رائعة يتغيَّر عشوائيًّا كل يوم. ومن ثم، أقدِّم لكم في هذا الجزء بعضَ الأمور التي اعتبرتُها رائعةً للغاية، ولكن إذا نظر إليها البعض باعتبارها مملةً، فلا بأسَ بهذا الأمر بالنسبة إليَّ.
كما أن بعض المقالات المذكورة في هذا الجزء تتناوَل موضوعاتٍ متعلقةً بدرجات الحرارة المنخفضة. كذلك، مع أن معظم كتاباتي معتمِدة على الأبحاث النظرية، فإن بعض الأمور الرائعة التي سأسردها فيما يلي قائمٌ على الجانب التطبيقي، الذي من المأمول أن يساهم في تقدُّم الوسائل التكنولوجية الرائعة في المستقبل.

الفصل الأول
الحياة على الصخور


مجددًا، دعونا نتمعن الأمورَ ونستهلَّ هذا الجزءَ بالحديث عن شيءٍ رائع يتيح للكائنات الرائعة الحياةَ في درجات الحرارة المنخفضة.
الماء السائل هو أحد أهم متطلبات الحياة؛ فالميكروبات التي تعيش في أعماق البحار لا تستطيع أن تنمو إلا في درجة حرارة تصل إلى ??? درجة مئوية؛ لأن ضغط عمود الماء فوقها يرفع نقطة غليان الماء إلى ما فوق درجة الحرارة هذه. ومع أن الكائنات الحية التي تعيش في أقصى حدود درجات الحرارة البيولوجية لا تتلقَّى عونًا كبيرًا من الظروف الفيزيائية المحيطة، فإن العديد من الكائنات الحية التي تعيش في المناطق الثلجية تستطيع أن تحافظ بقوة على الماء في حالته السائلة التي تُعتبَر ضروريةً لبقاء هذه الكائنات على قيد الحياة.
من واقع تجاربنا اليومية، فإننا نعرف طرقًا متنوعة نتجنَّب بها الضررَ الناتج عن التجمُّدِ. فسائقو السيارات، على سبيل المثال، يضيفون عوامِلَ مضادَّة للتجمُّد (مثل كحول جليكول الإثيلين) إلى ماء التبريد وماء ماسحات الزجاج في سياراتهم، كما يمكن إذابة الثلج على الطرق الثلجية بواسطة الملح. يذوب كلا العنصرين بسهولة شديدة في الماء، ولكن لا يمكن أن تحتوي البلورات الثلجية عليهما؛ لذا فإنهما يُخِلَّان بالتوازن القائم بين الحالة السائلة والحالة الصلبة للماء لصالح الحالة السائلة، وبالتالي يُقلِّلان نقطةَ التجمُّد بضعَ درجات.
لا تتمتَّع الأسماك التي تعيش في المياه القطبية بميزة درجة حرارة الجسم المرتفعة دائمًا التي نتمتَّع بها نحن ذوي الدم الحار، إلا أن طريقة سائقي السيارات المعتمِدة على خلط تركيزات عالية من الجزيئات الصغيرة في سوائلها الجسدية ستعرضها للخطر أيضًا؛ فالميل الطبيعي إلى معادلة التركيزات (التناضح) سيجذب الماءَ إلى خلاياها ويولِّد ضغطًا تناضحيًّا يمكن أن يدمِّرَها، على الأقل بقدر ما يمكن أن يفعل التجمُّد والذوبان. لهذا السبب، طوَّرت سلالات متنوعة من الأسماك بروتيناتٍ مضادَّةً للتجمُّد تتفاعَل على وجه التحديد مع أدق الروابط الصلبة لجزيئات الماء التي تبدأ عملية التجمد، والتي تُعرَف باسم نوى التبلور. وعن طريق ربط تلك النوى، تمنعها البروتينات المضادة للتجمُّد من النمو في صورة بلورات ثلج أضخم؛ مما يقلِّل بفاعليةٍ نقطةَ التجمد في بيئتها الحالية.
على النقيض من ذلك، تفعل سلالاتٌ معينة من الضفادع والسلاحف العكسَ تمامًا؛ فهي تتجنَّب الضررَ بتسهيل تجميد سوائل أجسامها باستخدام بروتينات التنوي الثلجية التي تحفِّز تكوين نوى التبلور. والتجمُّد السريع الذي يبدأ في نفس الوقت في العديد من تلك النوى يحافظ على بلورات الثلج صغيرةً للغاية بحيث لا تستطيع أن تسبِّب أيَّ ضررٍ ميكانيكي. وتمتلك أيضًا البكتيريا مجموعةً من بروتينات صدمة البرد — إلى جانب بروتينات الصدمة الحرارية المدروسة بإسهابٍ — لمساعدتها على تجنُّب عواقب هبوط درجة الحرارة.
إذن نحن ننظر إلى تفاعُلات معينة للجزيئات الحيوية مع نوى الثلج التي بدأت لتوِّها في التكوُّن إما لمنعها من النمو وإما لتسهيل تكوُّنها ونموها، وهي مشكلة تبدو معقَّدةً وتتطلب بنًى جزيئيةً متطوِّرة. ومع هذا، فإن حلَّ أول بنية بلورية لهذا البروتين كشف عن تصميمٍ بسيط يثير الدهشة؛ فالبروتين المضاد للتجمُّد في السمك المفلطح سيدوبلويارنكتس أمريكانوس، الذي يتكوَّن من ?? بقية حمض أميني، يكون ملفوفًا بالكامل ليشكِّل حلزونَ ألفا أحاديًّا ذا تِسْع لفَّاتٍ. فُوجِئ الباحثون باكتشافهم أن مثلَ هذه البنية البسيطة، المفتقِرة إلى اللُّب المانع للماء الذي يُعتقَد أنه مهِمٌّ للبنى البروتينية، يمكن أن تكون مستقرةً وفعَّالةً. وهم ينسبون الاستقرار غير العادي الذي يتَّسِم به هذا الحلزون الأحادي إلى بنًى خاصة تاجية الشكل ومرتبطة بالروابط الهيدروجينية عند كلا طرفَي الحلزون.
ومن المثير للدهشة أيضًا ملاحظة أن البروتين يحتوي على تسعة أنواع فقط من العشرين نوعًا المختلفة المتاحة من عناصر الحمض الأميني الأساسية. عندما ينظر خبراء البروتين إلى التسلسل النووي، لا يجدون صعوبةً في تخمين بقايا الحمض الأميني التي تساهم في عملية الارتباط الثلجي؛ إذ يستولي الألانين — الذي لا يصلح لهذا الغرض — على أكثر من نصف المواضع. ويعتقد الباحثون أن جميعَ البقايا الأربع عشرة غير المرتبطة بالألانين تلعب أدوارًا مهمة، سواء في استقرار الحلزون أو في التعرُّف على البلورات الثلجية والارتباط بها. وقد عُرِف تتابُع الارتباط بالثلج بصفته ثالوثَ الأحماض الأمينية: الأسباراجين والثريونين والليوسين، الذي يتكرَّر في كل لفة ثالثة للحلزون. ونفس النظام موجود في البروتينات الحلزونية الكبرى المضادة للتجمد، التي يتكرَّر فيها نفسُ تتابُع الارتباط خمسَ مرات. وتكوِّن هذه البقايا سطحًا مستويًا على نحو مفاجئ، تبرز منه قليلًا سلسلتا الأسباراجين والثريونين الجانبيتان، اللتان تستطيعان تكوين روابط هيدروجينية ذات بِنًى متكررة بانتظام على أسطح معينة من البلورات الثلجية؛ وبالتالي تمنع البلورات من النمو.
على عكس مجموعة البروتينات الحلزونية المضادة للتجمد (النوع الأول من البروتينات المضادة للتجمد) ببساطتها المفاجئة، فإن النوع الثالث من البروتينات المضادة للتجمد الموجودة في أسماكٍ أخرى تعيش في المحيط، مثل سمك الحدوق، تتَّسِم ببنية أكثر تعقيدًا بعض الشيء. فعلى الرغم من صِغَر حجمها نسبيًّا، فإنها تتميز ببنية مطوية معقَّدَة لا يتضح انتظامها ولا ما يدل على تتابعات الارتباط الثلجي. بعد أن تعرف الباحثون على بنية النوع الثالث من البروتينات المضادة للتجمُّد بواسطة مطياف الرنين النووي المغناطيسي، ظلوا في حاجة إلى دراسات مضنية تتناول الأحماضَ الأمينية بالتبادل واحدًا تلو الآخَر؛ لكي يكتشفوا أيُّها ضروري من أجل التفاعل مع البلورات الثلجية. وفي نفس الوقت، يبدو أنه من بين جدائل التسلسُل الثماني المشتركة في تكوين بنى صفائح بيتا المطوية، فإن الجديلة الأقرب إلى نهاية التسلسل (الطرف الكاربوكسيلي) هي التي تكوِّن موقعَ الارتباط.
لا يزال الباحثون متحيِّرين بشأن النوع الثاني من البروتينات المضادة للتجمُّد، التي توجد في سمك الرنجة على سبيل المثال. ففيما يتعلَّق بهذه البروتينات، لا توجد بيانات بنائية فعلية بعدُ، بل مجرد نماذج بنائية افتراضية قائمة على صلة قرابة بعيدة بعضَ الشيء مع مجموعةٍ من بروتينات النبات المسمَّاة اللكتينات.
لا توجد معلومات كثيرة معروفة عن بروتينات التنوي الثلجية التي يسبِّب تفاعُلُها مع نوى التبلور الثلجي تأثيرًا عكسيًّا، وتحديدًا تسهيل التنوي والتجمُّد السريع. يمكِّن هذا التأثيرُ بعضَ سلالات الضفادع والسلاحف من النجاة من التجمُّد دون ضرر، مع أن ??? من المحتوى المائي في أجسامها قد يتحوَّل إلى ثلج. تفرز بعضُ الكائنات الحية الدقيقة بروتيناتٍ لها وظائفُ مماثلة، خصوصًا من جنس «سودوماناس» و«زانثوموناس» و«إيروينيا»، من أجل التحكم في تكوين الثلج في بيئتها الحالية. وبما أن هذه البروتينات تحتوي على تكرارات دائمة لتتابعات الارتباط، يشكُّ العلماء في أن ثمة بنيةً منتظمة الشكل — ربما تكون إحدى صفائح بيتا المطوية الكبيرة — تطابِق تكوُّنَ البلورات الثلجية الذي يحدث على فترات منتظمة.
بالطبع قد تجد الضفادعُ التجمُّدَ صعبًا على الرغم من ذلك، وثمة ما يدل على أنها تتأقلم مع هذا عن طريق تخليق بروتينات معينة خاصة بصدمة البرد، مماثِلةً لبروتينات الصدمة الحرارية التي تنتجها معظمُ الكائنات الحية عند تعرُّضها لدرجات الحرارة المرتفعة.
يأمل الباحثون في الحصول على المزيد من المعلومات عن وظيفة بروتينات صدمة البرد عن طريق دراسة البكتيريا، التي تتسم ببساطتها في مثل هذه الأمور الجوهرية. ومن ثمَّ، فقد تمَّ التعرُّف على بروتين صدمة البرد الرئيسي «سي إس بي إيه» CspA في «الإشريكية القولونية» وتوصيفه في عام ????، ولكن لم يتم حلُّ بنيته البلورية إلا بحلول عام ????، وهو متطابِق تمامًا مع بنية «سي إس بي بي» CspB في بكتيريا «العصويات الرقيقة» التي تمَّ التعرُّفُ عليها بعد ذلك بعام؛ مما يشير إلى أن هذه الوظيفة قديمةٌ من الناحية التطوُّرية وحدثَتْ قبل انقسام المملكة البكتيرية إلى البكتيريا الموجبة الجرام وتلك السالبة الجرام. تحتوي كلتاهما على بِنًى مماثِلة للبروتينات التي ترتبط بالأحماض النووية (ثمة تشابُه مع البروتين الريبوسومي «إس ?» S1، على سبيل المثال). ومع أن وظيفتها لم تتضح بعدُ، فإنها في الغالب غير مرتبطة مباشَرةً بالآثار الفيزيائية للبرد (مثلما تفعل البروتينات المضادة للتجمد)، ولكنها تساعد الخلية في تكييف وظيفتها مع حالة الإجهاد. ونتيجةً لجميع هذه الدراسات، يأمل الباحثون فيما هو أكثر من مجرد اكتشافِ المزيد من المعلومات عن آليات الاستجابة للظروف القاسية. (في هذا المجال، أصبحَتِ استجابةُ الصدمة الحرارية نموذجًا للدراسة، في حين أن ظروفًا قاسية أخرى مثل: البرد والضغط ودرجة الحموضة (الأس الهيدروجيني) البالغة والتركيز المِلحي العالي، لم تَنَلْ نصيبَها من الدراسة المتمعنة.) علاوة على ذلك، يأمل علماء التكنولوجيا الحيوية في ترجمة معرفتهم التفصيلية عن الآليات الطبيعية إلى تطبيقات زراعية، وقد حاولوا بالفعل أن يجعلوا نباتَ البطاطس يُنتِج البروتينَ المضاد للتجمد الموجود في السمك المفلطح؛ على أمل ابتكارِ نوعٍ من البطاطس قادِرٍ على النمو في جبال الأنديز المرتفعة. ويعمل بروتين التنوي الثلجي المأخوذ من «سودوموناس سيرينجا» بالفعل في التصنيع الروتيني للثلج الصناعي، وفي يوم من الأيام، ربما يستخدم سائقو السيارات مُنتَجًا بيولوجيًّا لإزالة الجليد عن سياراتهم في صباح الأيام الشتوية الباردة.
(????)
أحدث التطورات

بعض الفجوات التي سُلِّط عليها الضوءُ في هذا المقال تمَّ سدُّها منذ أن كتبتُها؛ فهناك الآن بنًى تفصيلية للنوع الثاني من البروتينات المضادة للتجمد، التي اتضح فعلًا أنها مرتبطة باللكتينات. وبالنسبة إلى بروتينات التنوي الثلجية، فإنه توجد على الأقل نماذج لها. ومنذ عام ????، استُخدِمت البروتينات المضادة للتجمُّد التي كوَّنَتْها مستنبتات الخميرة في إنتاج الآيس كريم؛ إذ إنها تساعد في الحيلولة دون تكوُّن بلورات ثلجية ضخمة في الآيس كريم على نحوٍ غير مرغوب فيه.
قراءات إضافية

M. Gross Life on the Edge, Plenum, 1998.

الفصل الثاني
ألوان الجسيمات الكميَّة


في كتابي هذا، ستجدون ميكانيكا الكم من الموضوعات الرائعة بلا شك. ومع هذا، فيا ليت آثار الميكانيكا الكمية — المقتصرة عادةً على الأجسام الدقيقة التي لا تُرى بالعين المجردة — كانت مرئيةً، مثلما في تغيُّر الألوان! وهذا ما جذبني في البداية إلى الجسيمات الكميَّة، التي هي موضوعُ واحدةٍ من المقالات العلمية الخمس الأولى التي كتبتُها.
إذا أراد المرء أن يشقَّ جسيمًا أحمر إلى نصفين، فمن المتوقَّع أن يَنتج جسيمان أحمران في الغالب. ولكن في حالة الجسيمات الكميَّة، لا تكون الأمور بهذه البساطة؛ فهذه الحُبيبات الدقيقة للمواد شبه الموصلة التي يبلغ عرضها مجرد بضعة نانومترات، يمكن أن تكون سوداء أو بنية أو حمراء أو صفراء، كلٌّ منها بحسب حجمها. ويُفسَّر «الكم» باعتباره تحذيرًا بأن الآثار العجيبة لميكانيكا الكم مرتبِطة بهذه الغرابة.
شكل ?-?: آلية عمل أشباه الموصلات. عادةً ما تحتلُّ الإلكترونات في المواد الصلبة أيًّا من «نطاقَي» الطاقة، حيث قد يكون نطاقُ التكافؤ أو النطاق الأدنى مملوءًا جزئيًّا أو كليًّا، ويصبح من اللازم استخدام الطاقة لتحريك الإلكترونات إلى نطاق التوصيل أو النطاق الأعلى. في حالة المعادن، يكون النطاق الأدنى مملوءًا جزئيًّا، وبالتالي توجد مساحات فارغة تستطيع الإلكترونات الانتقالَ إليها بسهولة. وفي حالة المواد العازلة، يكون نطاق التكافؤ مملوءًا، ونطاق التوصيل عاليًا لدرجة أن الإلكترونات لا تستطيع عادةً الانتقال إليه. ولكن في حالة أشباه الموصلات، يكون فرق الطاقة — أو فجوة النطاق — صغيرًا للغاية لدرجة أنه يمكن التغلُّب عليه بسهولة، عن طريق الطاقة الضوئية على سبيل المثال.
لكي نفهم هذه التغيُّرات اللونية وبعض الخواص المهمة الأخرى التي تتسم بها الجسيمات الكميَّة، علينا أولًا أن نفهم السببَ وراء كون أشباه الموصلات شبه موصِّلة، ولماذا تختلف عن كلٍّ من المواد الموصلة والعازلة. لا تتكون المعادن الصلبة ولا أشباه الموصلات من جزيئات، وإنما من مصفوفات هائلة من الذرات. والإلكترونات لم تَعُدْ موجودةً في سُحُبٍ محدَّدة المعالم (مدارية) تحيط بكل ذرة، ولكنها تغشي الجسم الصلب كله فيما يُسمَّى النطاقات. وما يميِّز أشباه الموصلات أنه من بين النطاقين اللذين يمكن لإلكتروناتِ أيةِ مادةٍ في الحالة الصلبة أن ترتكز عليهما، فإن النطاق ذا الطاقة الأدنى (نطاق التكافؤ) يكون مشغولًا بالكامل، في حين أن النطاق ذا الطاقة الأعلى (الحالة المثارة أو نطاق التوصيل) يظل خاويًا (انظر الشكل ?-?). وفي هذه الحالة، يعجز كلا النطاقين عن نقل أيِّ شحناتٍ؛ فهما لا يوصلان إلا عندما تُقذَف الإلكترونات من النطاق الأدنى إلى النطاق الأعلى، عن طريق نوعٍ من طاقة الإثارة التي قد تنبع من الضوء أو الحرارة أو المجالات الكهرومغناطيسية. إذا حفَّزتْ موجات الضوء هذه الإثارة، فإن أطوالًا موجية معيَّنة من الضوء تُمتَصُّ خلال هذه العملية، بناءً على عرض فجوة الطاقة بين النطاقين («فجوة النطاق»). وهذا الامتصاص الانتقائي لبعض أجزاء الطيف المتصل من الضوء المرئي هو السبب وراء ظهور هذه المواد ملوَّنةً، فنحن نرى لونَ الضوء المتبقي الذي يكون مبعثرًا لا مُمتَصًّا. إذن، فإن الجسيمات الكميَّة تكون في منطقة وسطى بين المادة شبه الموصلة «على نحو مطلق» وبين الجزيء المكوَّن من بضع ذرات فقط. ويفسِّر هذا الوضعُ الفريد خواصَّها الغريبة. فعند مستوى النانومتر، تتسع فجوةُ النطاق — التي تُعتبَر خاصية مميزة وغير متغيِّرة في المواد شبه الموصلة الكبيرة — مع تضاؤل حجم الجسيم. ومن ثمَّ، يعتمد كلٌّ من لون الجسيمات واستجابتها الإلكترونية على حجمها.
كيف تتكوَّن هذه الجسيمات؟ إنَّ تكوينَ الجسيمات الكميَّة بأيِّ حجم لم يكن بالأمر الصعب. ففي حقيقة الأمر، يمكن أن يفعله طلابُ الكيمياء دون قصدٍ في عامهم الدراسي الأول؛ إذ يكون عليهم أحيانًا إنتاجُ كبريتيد الكادميوم — وهو عنصر كان يُستخدَم في مقاييس التعرُّض الضوئي قديمًا عندما كانت هذه المقاييس منفصلةً عن الكاميرا، وتقريبًا بنفس كبر حجمها — عن طريق فوران غاز كبريتيد الهيدروجين عبر محلولٍ يحتوي على أيونات الكادميوم. وإذا توافرت الظروفُ المناسبة، فقد يحصلون على جسيمات يبلغ قطرها بضعة نانومترات، تنساب بسهولة عبر ورق الترشيح. عادةً ما يثير هذا التأثير المذهل استياءَ الطلاب، الذين كانوا يقصدون فصلَ الكادميوم عن العناصر المُذابة الأخرى لكي يواصِلوا تحليلاتهم. لكن في حالة التحضير الكيميائي للجسيمات الكميَّة، يُعَدُّ هذا المسارُ أسهلَ سبيلٍ للوصول إلى البنى النانوية الحجم؛ فعلماء الكيمياء المهتمون باستكشاف عجائب عالم النانو، مثل هورست فيلر من جامعة هامبورج بألمانيا، عادةً ما يستعينون بهذا الأسلوب لتكوين الجسيمات الكميَّة.
لكن علماء الفيزياء، على النقيض من ذلك، يدرسون آثارَ ميكانيكا الكم في الجسيمات الدقيقة من منظور مختلف؛ إذ يستفيدون من التصغير المتواصِل لطرق التصنيع المجهري، فيحدِّدون مناطِقَ نانوية الحجم على الشرائح المجهرية إما بتآكُل العناصر المحيطة، وإما باستخدام مجالات كهربائية دقيقة. ويمكن دمج «نقاط الكم» الناتجة في أجهزة إلكترونية.
وبالمعالجة الدقيقة بواسطة فولتات كهربائية صغيرة للغاية، يمكن حثُّ البلورات الكميَّة لتتصرف مثل «الذرات الصناعية». إذا نقلنا إلكترونًا واحدًا فقط من نطاق التكافؤ إلى نطاق التوصيل، فسيحتفظ النطاقُ الأول بشحنة موجبة، والثاني بشحنة سالبة؛ وبالتالي نحصل على شحنتين تتطابقان مع أبسط ذرة (الهيدروجين). تتميز الذرات الصناعية بأنه يمكن اختيار عدد شحناتها بمطلق الحرية، وبالتالي يستطيع الباحثون إجراءَ دراساتهم عبر عناصر الجدول الدوري باستخدام نظامٍ نموذجيٍّ واحد فقط. وهي مفيدة بصفة خاصة لاختبار توقُّعات نظريات ميكانيكا الكم بتجارب بسيطة.
ثمة مجال ثالث يرتبط بكلٍّ من الأساليب الفيزيائية والكيميائية لجسيمات النانو شبه الموصلة، وهو كيمياء التجمُّعات المعدنية. هذه الأجسام الكيميائية التي قد تحتوي على ما يصل إلى بضعة عشرات من الذرات المعدنية، تعكس أيضًا آثارًا كميَّة، وإنْ كان ذلك في نطاق حجم أصغر من أشباه الموصلات. وأحد الأنواع المهمة لتجمُّعات الذهب سبق وتناولناها في مقال «تجمُّعات الذهب اللامعة البرَّاقة». ومع أن هذه المجالات البحثية الثلاثة تشهد تطوُّرًا مستقلًّا على مدار أكثر من عقد من الزمان، فإن التطورات التي تمَّ التوصُّلُ إليها في تسعينيات القرن العشرين تشير إلى أنها تتفق على فهمٍ جديد وأعمق للآثار الكميَّة في الجسيمات النانوية الحجم.
ستكون الجهود الموحدة لجميع الباحثين وقدراتهم الإبداعية مطلوبةً لدفع هذه المواد المثيرة للاهتمام إلى نطاق التطبيقات المفيدة، فعلى الرغم من أنها ظلَّتْ موضوعًا علميًّا بحتًا حتى الآن، يمكننا تخيُّل العديد من التطبيقات العملية لها، فيمكن استخدامها — على سبيل المثال — في تصميم ألواح شمسية أفضل، معتمِدة على مواد مسامية مغطَّاة بالجسيمات الكميَّة؛ فعن طريق تنويع أحجام الجسيمات على النحو المناسب، يمكن للمرء ضبطُ امتصاص الألواح لخواصِّ ضوء الشمس؛ وبالتالي يُحسِّن استغلالَ محتواها من الطاقة الشمسية.
خلال التفاعلات الكيميائية، تشير النسبة العالية من الذرات ذات السطح المكشوف في هذه المواد إلى أنها ستكون مناسِبةً للتحفيز الكيميائي. فعلى سبيل المثال، تُعتبَر جسيمات النانو الخاصة بأكسيد التيتانيوم وسيلةً للمعالجة التحفيزية للفضلات السائلة.
إلا أن الميزة الكبرى تكمن في مجالَي الإلكترونيات والإلكترونيات الضوئية؛ فعن طريق استخدام الجسيمات الكميَّة شبه الموصلة، لا يستطيع المرءُ فقط تحويلَ ضوء ذي طول موجي محدَّد إلى تيار بطريقة انتقائية، ولكنه يستطيع أيضًا أن يجعل الجسيمات تضيء عن طريق تعريضها لجهد كهربائي. وفي التطبيقات الفيزيائية، يتمنَّى المرءُ بالتأكيد استغلالَ حقيقة أن الجسيمات الكميَّة تتيح «التعامُلَ مع» إلكترونات أو فوتونات بعينها. ويتدارس علماء الفيزياء بالفعل الترانزستورات الأحادية الإلكترون، والمحوِّلات البصرية؛ فقد تصبح هذه العناصر مستخدَمةً في أجهزة الكمبيوتر الفائقة المستقبلية.
(????)
أحدث التطورات

بينما كنتُ منشغلًا عن هذا المجال، يبدو أن مصطلح «الجسيمات الكميَّة» لم يَعُدْ متداولًا لدرجة أنه لا يظهر في موسوعة ويكيبيديا، كما أن الدراسة التلخيصية لفيلر في عام ???? لا تظهر في قمة نتائج البحث على محرك جوجل. أعتقِد أن تجاهُلَه كان بسبب الاستخدام غير المقصود لمصطلح «نقطة الكم»، مع أنني وجدتُ أن كلا المفهومين مفيدٌ. حسنًا، فَلْترقدِ الجسيماتُ الكميَّة في سلامٍ، بينما تواصِل نقاطُ الكم المنافَسةَ من أجل تصنيع أول كمبيوتر كميٍّ مفيدٍ حقًّا، وهو الذي سأتناوله لاحقًا.
قراءات إضافية

H. Weller, Angew. Chem. Int. Ed. 1993, 32, 41.

الفصل الثالث
بلورات مصممة وفقًا للمقاييس


كنتُ معجبًا جدًّا بمؤتمرات البحث الأوروبي التي تنظِّمها مؤسسة العلوم الأوروبية، والتي هي عبارة عن اجتماعات ودية صغيرة، تتناول في العادة موضوعات متعدِّدة الاختصاصات في العلوم. في عام ????، حضرتُ أحد هذه المؤتمرات، الذي كان يدور حول التعرُّف الجزيئي (كنتُ أدرسُ التعرُّف الركائزي للبروتينات المقترنة في ذلك الوقت). اكتشفتُ بحثًا رائعًا للغاية هناك، وشرعتُ في كتابة أول مقالٍ لي عنه.
دعونا نسافر عبر الزمن إلى باريس في عام ????. هناك سنجد عالِمَ كيمياء حديثَ التخرُّج، يبلغ من العمر ?? عامًا، متحيِّرًا للغاية؛ فهو يتعجَّب باستمرار لماذا يلف حمض الطرطريك سطحَ الضوء المستقطَب، في حين أن الحمض الراسيمي — المطابِق بجميع المعايير الكيميائية — يتركه دون تغيير؟ وقد جهَّزَ محاليل مفرطة التشبُّع للمركب غير النَّشِط ضوئيًّا وتركه ليتبلور طوال الليل على عتبة نافذة معمله، وعندما فحص البلورات بالميكروسكوب في اليوم التالي، اكتشف وجود نوعين من البلورات يتسمان بنفس البنية الهندسية، ولكن كان كلٌّ منهما صورة مطابقة للآخَر، مثل القفازين الأيمن والأيسر. وبالاستخدام الدقيق لمِلقط مع النظر عبر الميكروسكوب، فصلَ النوعين وأعاد إذابتهما على نحوٍ منفصل وفحص ما فعلَتْه المحاليلُ للضوء المستقطَب. تلك البلورات التي كانت في نفس «اتجاه» البلورات المأخوذة من محاليل الطرطرات سبَّبَتْ تدويرًا في اتجاه عقارب الساعة بنفس الطريقة التي تتبعها الطرطرات. بينما وجَّه المحلول الآخَر سطحَ الضوء المستقطَب بنفس الزاوية، ولكن في الاتجاه المعاكس. وبالتالي، ففي الوقت الذي كانت فيه الذرات والجزيئات لم تزل مسلَّمات محيِّرة، حدَّد هذا الرجل العلاقةَ المباشِرة بين عدم التناظُر المِرآتي (اليدوانية) للجزيئات (حسبما تمَّتْ ملاحظته خلال النشاط البصري)، وعدم التناظُر المِرآتي للبلورات التي تكوِّنها. وبالطبع، لم تكن تلك سوى البداية في مسيرة لوي باستير (????–????).
بعد ذلك بأقل من قرن ونصف، خطَا باحثون في فريق ليا أدادي من معهد فايتسمان في رحوفوت بإسرائيل على خُطَى باستير، فشرعوا في تصنيف البلورات التي تكوِّنها الجزيئات المنعكسة (المصاوغات المِرآتية) باستخدام الميكروسكوب. وهذه المرة كان العنصر العديم التناظر المِرآتي هو ملح حمض الطرطريك، وتحديدًا طرطرات الكالسيوم. بَدَا أنه من المستحيل التمييزُ بين بلورات المصاوغات المرآتية؛ لأنها متماثِلة في المظهر، وليس في التناظُر المِرآتي. ومع هذا، إذا عرَّض الباحثون أنواعًا معينة من الخلايا الحية — مثل خلايا الكُلى المستنبتة والمأخوذة من العلجوم ذي المخالب «القيطم الأفريقي» — لاحتكاكٍ مباشِر مع البلورات المختلطة، فإنها ستبدو قادرةً تمامًا على التمييز بين البلورات المتماثلة في المظهر. في المرحلة الأولى من التجربة اختاروا حصريًّا سطحًا معيَّنًا للبلورات يكوِّنه المصاوغ المِرآتي «آر آر» RR، وباستخدام إجراءٍ تصنيفي على طريقة باستير، لقياس النشاط البصري للمحاليل المشتقة من البلورات التي اختارت الخلايا أن تنمو فوقها بالمقارنة مع غيرها، استطاعت أدادي وزملاؤها إثباتَ أن نمو الخلايا على السطح البلوري هو معيارٌ موثوق به للفصل المصاوغاتي المِرآتي للبلورات التي ما كان سيمكن التعرُّف عليها لولاه. ومع هذا، فإن الخلايا التي اختارت بلورات «آر آر» في الساعات الأولى من التجربة خضعت لعواقب اختيارها بعد حوالي يوم واحد؛ فارتباط جزيئات سطح الخلية بسطح البلورات كان محكمًا بقوةٍ وشديدًا لدرجة أن الخلايا ماتَتْ كالحشرات العالقة بالورق المبيد للذباب. أما في حالة بلورات المصاوغ المِرآتي الآخَر، فقد كانت على النقيض من ذلك؛ إذ إن المستنبتات الخلوية الأصغر والأقل ارتباطًا بدأَتْ تنمو في اليوم الثاني وظلَّتْ على قيد الحياة لعدة أيام أخرى.
هذا الوصف للكيفية التي تستطيع بها جزيئاتُ سطح الخلية التعرُّفَ على عدم التناظر المِرآتي للجزيئات المكونة في البلورات المتماثِلة مجهريًّا هو مجرد مثال واحد للتفاعُلات المتنوعة والمحددة غالبًا على نحوٍ مُدهِش بين الجزيئات الكبرى الحيوية والبلورات الجزيئية الصغيرة. في عام ????، أثبتت أدادي وزملاؤها أن الأجسام المضادة التي أنتجوها لمقاوَمةِ الأملاح المتباينة من حمض البوليك ومقاوَمةِ التناظُر المحايد للألوبورينول، يمكن أن تحفِّز على نحوٍ متخصِّصٍ تكوينَ نوع البلورات التي أُنتِجتْ في الأساس لمقاومتها. ومع أن تخصُّصيةَ الأجسامِ المضادة قد تمَّ اختيارها للتعرُّف على البلورات الكاملة النمو، فقد بَدَتْ أنها تحفظ استقرارَ التجمُّعات الأولى لما بين ?? و?? جزيئًا تقريبًا خلال تنوي نمو البلورات. وبطريقة مماثِلة لتلك الأجسام المضادة التي أنتجها الباحثون لمقاومة تناظرات الحالة الانتقالية في التفاعلات الكيميائية البسيطة، التي اكتشفوا أنها تعمل كمادة محفِّزة عن طريق تقليلِ طاقة الحالة الانتقالية مثلما تفعل الإنزيمات؛ تبدو الأجسام المضادة التي أنتجَتْها أدادي موادَّ محفِّزةً متخصِّصةً لتفاعلات التجمعات الأكثر تعقيدًا التي تؤدي إلى تكوين البلورات.
وقد أدَّتِ الأبحاثُ الأحدث التي أجراها فريقها إلى إنتاج مستحضرات أجسام مضادة أحادية النسيلة، يتكوَّن كلٌّ منها من تسلسل بروتيني واحد محدَّد، كي تصبح الأبحاث البنيوية ممكنةً. وكشفت التنبؤات البنيوية لجسم مضاد معين مقاوِم لبلورات الكوليسترول شذوذًا حادًّا على نحو مدهش في موقع القَطع، الذي يطابق بالضبط الحواف الموجودة على سطح بلورة الكوليسترول.
حتى الآن، قد يُغفَر للمرء تفكيره في أن مثل هذه الأجسام المضادة هي مجرد لعبة كيميائية حيوية ممتعة، ولكنها في حقيقة الأمر نماذج لعملية فسيولوجية ذات أصول طبية هائلة؛ فأعراض نوبة داء المفاصل (النقرس) يُعتقَد أنها تنشأ من بلورات حمض البوليك المتراكمة في أحد المفاصل، التي تتعرَّف عليها عندئذٍ الأجسامُ المضادة للجهاز المناعي بوصفها أجسامًا غريبة (على الرغم من أن نفس المركب في صورته السائلة لا يحفِّز استجابةً مناعيةً)؛ وهو ما يؤدِّي بدوره إلى استجابةٍ التهابيةٍ في المفصل. وتشير نتائج التخصُّص التي توصَّلَ إليها فريقُ أدادي إلى أن تعرُّفًا مماثِلًا في المفصل المصاب هو السبب الأرجح المسبِّب للالتهاب. كما أنها تعطي فرصة لتخمين أن الجهاز المناعي قد يزيد الأمور سوءًا بتوفير أعداد كبيرة من الأجسام المضادة لمقاومة البلورات المهاجمة، التي تحفِّز دونَ قصدٍ تكوينَ المزيد من البلورات، وقد يفسِّر هذا سببَ زيادة عدد نوبات النقرس مع تقدُّم مراحل المرض؛ إذ إن الجهاز المناعي يعمل على نحو خاطئ تمامًا. علاوة على ذلك، لا يمكن للاستجابة المناعية أن تقضي على البلورات المهاجمة؛ إذ إن أنظمتها التطهيرية مصممة لكي تتمكَّنَ من مقاومة الخلايا والفيروسات والجزيئات الحيوية، بدلًا من مقاومة بلورات الجزيئات الصغيرة.
ومع هذا، فإن التفاعلات بين البروتينات وأسطح البلورات يمكن أيضًا أن تكون مفيدةً على نحو هائل للكائنات الحية التي تعتمد على التحكم في نمو البلورات، كما هو الحال في التشبُّع البيولوجي بالمواد المعدنية وفي الوقاية من التجمُّد (انظر مقال «الحياة على الصخور»). وأخيرًا، ثمة مجموعة أخرى من العمليات الطبيعية المهمة للغاية التي تعتمد على التفاعلات بين الجزيئات الكبرى الحيوية والمراحل البلورية أو اللابلورية للمواد الصلبة، وهي تتضمَّن العمليات التي تكوِّن عظامنا وأسناننا، وتلك التي تمد اللافقاريات مثل الرخويات والحلزونات بصَدفة خارجية صلبة، لتغطِّي تكوينَ أكثر من ?? معدنًا مختلفًا ونطاقًا هائلًا من الظواهر، التي يُطلَق عليها بصفة عامة التشبُّع البيولوجي بالمواد المعدنية.
يمكن أن تقرر الجزيئات الحيوية التي تتحكَّم في هذه العمليات إن كان ترسُّب الصورة المعدنية من المحلول يؤدِّي إلى مرحلة لا بلورية أو مرحلة بلورية (مجهرية)، ويحفِّز البلورة، ويغيِّر الانحرافَ بين الصور البلورية (التشكُّلات) المختلفة، ويوجِّه أو يقيِّد اتجاهات نمو الخلايا في الفراغ، ويوقف العملية برمتها. في معظم الحالات (ولكن ليس في حالة عظامنا)، تنتمي هذه العوامل المتحكِّمة إلى فئةٍ من البروتينات مذهلةٍ للغاية، لدرجة أنه يُشار إليها غالبًا باسم «الجزيئات الكبرى الحمضية العجيبة». (كان المثال الأول عبارة عن بروتين مستمَد من الأسنان خلال ستينيات القرن العشرين، وُجِد أنه يحتوي على ?? مولًا في المائة من حمض الأسبارتيك.) بصفة عامة، تحتوي هذه الجزيئات على حمض الأسبارتيك مرةً كل موقعين أو ثلاثة، كما تحتوي أيضًا على نِسَب عالية للغاية من الأحماض الأمينية المُفَسْفَرة، لا سيَّما الفوسفوسرين. وتؤدِّي جميع هذه الخواص غير العادية إلى مشكلةٍ مفادها أن هذه البروتينات يصعب للغاية تحليلها ووصفها بالوسائل التقليدية، حتى إن تحديدَ الوزن الجزيئي غالبًا ما يسبِّب مشكلاتٍ. ومن المحتمَل أنها تستطيع تكوين بنى صفائح بيتا ممتدة مشابهة لتلك الخاصة ببروتينات التنوي الثلجي. ومع أن التحكُّم في التشبُّع بالمواد المعدنية بواسطة هذه الجزيئات يمكن محاكاته معمليًّا، فإن آلياتها لا تزال محل جدال. وسيكون من الممكن أن تعمل البروتيناتُ الحمضية في أغشية و/أو في محلول حر عن طريق التأثير على تكوين واتجاه النوى و/أو نمو البلورات.
في العديد من الحالات — فكِّرْ فقط في الشكل اللولبي لأصداف الحلزون التي تتلوَّى دائمًا في نفس الاتجاه — يؤدي التحكُّمُ في نمو البلورات بواسطة الجزيئات الحيوية العديمة التناظر المِرآتي إلى تكوين أجسام مجهرية تتسم بعدم التناظر المِرآتي تمامًا مثلما فعلَتْ بلورات باستير. والمثير للدهشة أن هذا قد يحدث حتى لو كانَتِ العناصرُ الأساسية الجزيئية (فوسفات الكالسيوم في حالة الحلزون) عديمةَ التناظر المِرآتي.
(????)
أحدث التطورات

لطالما ظلَّ التفاعلُ بين البلورات الصلبة والبروتينات المفترَض أنها غير صلبة يذهلني في سياقاتٍ متنوعة؛ ولهذا تناولتُ العديدَ من التطوُّرات الأخرى في هذا المجال، خصوصًا الجزيئات المشتركة في تكوين أصداف الدياتوم، انظر مقال «الانبهار بالدياتومات». وقد نجحَتْ جوانا أيتسنبِرج — تلميذة أدادي — في التعامُلِ مع الوسيط المعدني البيولوجي/تكنولوجيا النانو، لتُحدِث ضجةً باكتشافها «الأليافَ البصرية» في الإسفنج البحري في عام ????.
قراءات إضافية

M. Gross, Travels to the Nanoworld, Perseus, 1999.

الفصل الرابع
الراسمة النانوية المدهشة


تكنولوجيا النانو اكتشافٌ رائع، أو هذا ما أتمنَّاه (على الرغم من أنني لم أراجِع الأمر مع الأولاد بعدُ). بعد أن نشرْتُ كتابَ «مغامرات في عالم النانو»، الذي استعرضتُ فيه طرقَ استفادة تكنولوجيا النانو من الأنظمة النانوية البيولوجية، حاولتُ أن أواكِب هذا المجالَ السريع الإيقاع بكتابة مقالٍ من وقتٍ إلى آخَر عن الأجهزة والأدوات النانوية الجديدة. فاجأَتْني تقنيةُ الطباعة بانغماس القلم كواحدةٍ من أروع هذه الأدوات. علاوة على ذلك، بصفتي كاتبًا، فإنني أهتم بتقنيات الكتابة الجديدة، ولديَّ أيضًا مثال مبكِّر (ومستفيض) لنسق الكتابة المفضَّل إليَّ، وهو المقال المصغَّر المكوَّن من ??? كلمة، الذي شهد عصره الذهبي في الفترة ما بين عامَيْ ???? و????، عندما كنتُ أساهِم بانتظام بصفحة واحدة في عمود «فرنتيرزر» بمجلة «كميستري إن بريتين».
في ديسمبر ????، تحدَّى عالِم الفيزياء الشهير ريتشارد فاينمان زملاءه لتقليص صفحة كتاب بمقدار ?? ألف مرة. ويقلِّص معامِل التصغير هذا طولَ كتاب ورقي كبير (??سم) إلى أقل من جزء من المائة في الملِّيمتر (?? ميكرونات) بما يلائم تقريبًا حجم خلية دم حمراء. بينما يقلص طول حرف كبير عادي (بنوع خط Times Roman، وحجم ?? نقطة) من ثلاثة ملِّيمترات إلى جزء من العشرة في الميكرون، وبالتالي يمكن أن تبتلعه بكتيريا واحدة. والآن، يُنظَر إلى خطبة فاينمان، التي ألقَاها بعد الغداء وشجَّعَ فيها زملاءه من العلماء على «التفكير في التصغير»، على أنها لحظة ميلاد المفهوم المستقبلي لتكنولوجيا النانو، تلك التكنولوجيا المعتمِدة على آلات صغيرة بصِغَر حجم الجزيئات الموجودة في الخلايا الحية. مضَتْ ستة وعشرون عامًا قبل أن يتحوَّل حلم فاينمان إلى واقع. ففي عام ????، برمَجَ توماس نيومان — خريج جامعة ستانفورد — جهاز أشعة إلكترونية لنَسْخ أول صفحة من رواية ديكنز «قصة مدينتين»، وذلك بطبع كلِّ حرف من حروفها على سطح أصغر من سن الإبرة. رُسِمت الحروف بأبسط شكل ممكن، وكان حجم الخطوط والنقاط حوالي ?? ذرة عَرضًا. ولا تزال الطباعة بالأشعة الإلكترونية أدق الأدوات التي توصَّلنا إليها لتكوين بنًى متناهية الصغر، إلا أنها غير صالحة للتطبيق تجاريًّا بالنسبة إلى الأعداد الكبيرة من النُّسَخ؛ لأنه يجب رسم السمات بالتعاقُب (نقطة تلو الأخرى) بدلًا من طباعتها كلِّها دفعة واحدة.
في مجال التصنيع، تُستخدَم الموجات الضوئية لطباعة أنماط صغيرة بأعداد هائلة من النُّسَخ، فتُنسَخ من أصلٍ (وجه) واحدٍ عادةً ما يصنعه شعاع من الإلكترونات. وهذه هي الطريقة التي تُصنَّع بها رقاقات الكمبيوتر. وتوجد أيضًا طُرُقٌ مماثلة تُستخدَم في إنتاج الأجهزة الكهروميكانيكية المجهرية، بما في ذلك المجس المسئول عن تشغيل معظم الوسائد الهوائية المستخدَمة في السيارات اليوم. ولكن، بما أن الطول الموجي للضوء المرئي يبلغ حوالي نصف ميكرون، فإنه من الصعب للغاية تطبيق هذه الطرق على مقياس ??? ميكرون (??? نانومتر) الذي تخيَّلَه فاينمان. ونظرًا لأن الأطوال الموجية المطلوبة تتغيَّر بدرجة كبيرة في نطاق المنطقة فوق البنفسجية غير المرئية، ثم أخيرًا في نطاق الأشعة السينية، فإن الطباعة الضوئية تصبح أكثر تعقيدًا. وغياب البصريات المناسبة لتركيز الأشعة السينية يقيِّد هذه التقنيةَ بشدة.
على النقيض من ذلك، يَسهُل تركيزُ الشعاع الإلكتروني، ولو حتى بمقاييس متناهية الصغر. ويقتصر استخدامه فقط على آثار ميكانيكا الكم التي تجعل الحياةَ مثيرةً بالمقياس الذري؛ فهو يستطيع إنتاجَ سمات في صِغَر عشرة نانومترات عَرضًا. وفي العادة، فإنه يُستخدَم لتصنيع نماذج أولية أو لتصنيع بنًى لازمة في الأبحاث، بالإضافة إلى الأقنعة المستخدَمة في الطباعة الضوئية. ولكن إذا حاولنا زيادةَ مقياس طريقة الكتابة اليدوية هذه لإنتاج أعداد كبيرة من النُّسَخ بكفاءة معقولة، فسيكون الأمر أشبه بإجبارِ الرُّهبان الذين يكتبون بالريش على منافسة آلة الطباعة.
لكن مع طرح نوع جديد من مقاييس النانومتر «انغماس القلم»، بدأت موازين القوى تتغيَّر لصالح الرُّهبان؛ ففي عام ????، استعان تشاد ميركين من جامعة نورثويسترن في إيفانستون بولاية إلينوي بميكروسكوب القوى الذرية (وهو أداة عادةً ما تُستخدَم لتصوير بنى الأسطح الصغيرة غير المرئية) لتنفيذ كتابةٍ يدوية دقيقة ? «الحبر» الجزيئي على لوحِ «ورق» مصنوعٍ من الذهب. وقد استعان بتأثيرٍ عادةً ما يضايِق الأفرادَ الذين يريدون استخدامَ ميكروسكوب القوى الذرية في أغراضه الأصلية التي صُنع أساسًا من أجلها، فالمسافة المتناهية الصِّغَر بين السطح المقصود وأقصى طرف في ميكروسكوب القوى الذرية تجذب الرطوبةَ وكأنها أنبوبٌ شِعري. وإذا لم تُجرَ التجربةُ في بيئة جافة تمامًا، فسيظل يوجد دائمًا سطح هلالي من الماء يربط الطرف بالركيزة. وفي التقنية الجديدة، التي أطلق عليها ميركين «الطباعةَ النانوية بانغماس القلم»، فإن هذا السطح الهلالي للماء يكون بمنزلة شريحة تنزلق عليها الجزيئات العضوية التي تصنع الحبر وصولًا إلى سطح الذهب.
شكل ?-?: الطباعة النانوية بانغماس القلم. تعتمد هذه الطريقة، التي ابتكرها فريقٌ بقيادة تشاد ميركين، على نقل سائلٍ من طرف ميكروسكوب القوى الذرية إلى أحد الأسطح.
عن طريق تغذية طرف الميكروسكوب بالحبر، أدرك الباحثون أن السرعة التي انتشر بها الحبر على سطح الذهب تعتمد بصورةٍ حاسمة على أبعاد السطح الهلالي للماء، الذي يمكن أيضًا التحكُّمُ فيه بتنويع رطوبة الجو المحيط. وأتاح هذا لهم رسمَ نقاطٍ وخطوطٍ ذات كثافة محكَمة جيدًا، وبلغ عَرض أرفع الخطوط التي استطاعوا إنتاجها ?? نانومترًا، وهو ما سيكون مناسبًا للصفحة المطبوعة المختزلة بمعدل ?? ألف مرة التي يتطلَّبُها تحدِّي فاينمان. لكن لم تكن تقنيةُ انغماس القلم نفسها هي ما منعهم من المضي قدمًا في هذا الشأن، وإنما البنية الحُبيبية لسطح الذهب الذي كانوا يكتبون عليه.
مثلما كان الأمر مع صفحة ديكنز المصغَّرة التي اختزلها نيومان، فإن هذا الإنجاز كان مثيرًا للإعجاب كأمرٍ يحدث لمرة واحدة فقط وعلى نطاقٍ محدودٍ، ولكنه لا يصلح للتطبيقات التقنية الموسَّعة، حيث سيتطلَّب الأمر غالبًا عملَ أعداد هائلة من النُّسَخ المتطابقة من بنيةٍ معينةٍ؛ ولهذا السبب، واصَلَ معملُ ميركين بحثَه لاحتمالات تصميم آلة تحتوي على عدة أقلام نانوية تكتب بنفس النمط تمامًا. وفي يونيو ????، أعلنوا نجاحَهم الأول في هذه التجربة في مجلة «ساينس».
لقد أدركوا — ويا لدهشتهم الشديدة — أن السرعة التي يسير بها الحبر من طرف الميكروسكوب إلى الركيزة لا تعتمد على القوة التي يُضغَط بها الاثنان معًا؛ مما أتاح لهم إعدادَ أكثر من طرفٍ لميكروسكوب القوى الذرية، بحيث يمكن التحكُّمُ فيها جميعًا بنفس الأسلوب. ويمكن التغاضي — دون قلق — عن الاختلافات الدقيقة بين القوى العمودية التي يتعرَّض لها كلُّ طرف، والتي قد تنشأ من عدم الانتظام في سطح ورق الكتابة. وبهذه الطريقة، أنتج الفريقُ ما أطلقوا عليه اسم الراسمة النانوية، التي تعمل بالتسلسل وبالتوازي، ويمكن للأطراف أن تلتقط الحبرَ من الأجزاء الدقيقة لورق الترشيح. وبالمثل، يمكن «غسلها» عن طريق تعريضِ ورق الترشيح المنقوع لمادة مذيبة مناسِبة.
بعد أن طبَّقوا المبدأَ بواسطة الراسمة النانوية ذات الطرفين، عمدوا إلى تصميم نسق يتضمَّن ثمانية أطراف، يمكن التحكُّم في طرف واحد منه بواسطة المشغِّلات، في حين تَنسخ الأطراف السبعة الأخرى عشوائيًّا بغضِّ النظر عمَّا فعله الطرف الأول. وبعد أن رسموا أشكالًا هندسية بسيطة مثل المربعات والمثمَّنات في ثماني نُسَخ، اكتشفوا أن مقاييس النُّسَخ متطابِقةٌ بحدود مقبولة، بل زعموا أيضًا أن «ما من سببٍ يمنعهم من زيادة عدد الأقلام ليصل إلى مئات أو حتى ألف» دون آليات تحكُّمٍ إضافية.
بالتالي، لن تقتصر الطباعة النانوية بانغماس القلم بعد الآن على الإنتاج اليدوي لنُسَخ فردية؛ إذ يمكن لدورة الطباعة العادية لصفحة ديكنز أن تتمَّ خلال يوم، والأهم من ذلك أن الاختيار الذكي للحبر والورق سيتيح لمهندسي النانو المستقبليين إنتاجَ عناصر بمقياس النانو لا يَسَعُ مصنِّعو الرقاقات اليومَ إلا أن يحلموا بها. ويمكن تأسيسُ مصانع نانوية كيميائية، حيث يتم توجيه أعداد متناهية الصِّغَر من الجزيئات لتتلاقَى في تسلسُل محدَّد من التفاعلات. ويمكن أن تكون العناصر الإلكترونية — بما في ذلك رقاقات الكمبيوتر — متناهيةَ الصغر للغاية، حتى إنها قد تكون بحجم النقطة في حرف i، أو تدخل حتى في الخلية الحية. وهكذا، فإن ثورة تكنولوجيا النانو التي كانت ضربًا من الخيال منذ أواخر ثمانينيات القرن العشرين أوشَكَتْ أن تتحقَّق.
(????)
أحدث التطورات

واصَلَ فريق ميركين استكشافَ إمكانات الطباعة النانوية بانغماس القلم بنجاحٍ كبيرٍ، فأنتجوا نُظمًا نانوية بروتينية وبنًى نانوية بهذه التكنولوجيا.
قراءات إضافية

R. D. Piner et al., Science, 1999, 283, 661.
K.-B. Lee et al., Science, 2002, 295, 1702.

الفصل الخامس
إسكات النشاز


استكمالًا لموضوع «الأدوات الرائعة»، فإن مُخمِد الجين الذي سأصفه فيما يلي هو الأداة الأروع في البيولوجيا الجزيئية الحديثة. لقد رصدتُ هذا الجزيء مبكرًا، بينما كانت الآلية لا تزال صعبة الفهم، وكان مصطلح تداخل الحمض النووي الريبي «آر إن إيه آي» غير معروف بعدُ، حتى بالنسبة إلى العلماء. ولكنه سرعان ما أصبح حديثَ الساعة، الأمر الذي تُوِّج بنيل جائزة نوبل عام ????.
تخيَّلْ أنك في حفل موسيقي ضخم، وأن أوركسترا مكوَّنة من ?? ألف عازف تعزف ما يُفترَض أنه موسيقي، إلا أن غالبية الألحان والإيقاعات متنافِرة لدرجةٍ تصيبك بالصداع، وتجد نفسك عاجزًا عن تمييز أيِّ ألحان أو إيقاعات أو أنغام، ولا تلمح وجود المايسترو، وتؤثِّر فيما يبدو عدة آلات موسيقية أو مجموعات منها بعضها على بعض، متبِعةً قواعد غامضة، ويغطي آلافٌ من عازفي آلات النفخ النحاسية على صوت الوتريات الهادئة، لولا أنهم هم أنفسهم غارِقون تحت عشرات من آلات الأرغن.
وبينما تسدُّ أذنيك يائسًا وتخطِّط للهرب، تجد المرأةَ الجالسة في المقعد المجاور لك مستمتعةً كثيرًا بوقتها، وتستمع للموسيقى في حالة انجذاب خلَّاب، وتُمسِك في يدها ما يشبه جهاز التحكم عن بُعْد الخاص بالتليفزيون أو مشغِّل الأقراص، وعندما تلاحظ نظرتك المذهولة، تعطيك جهازَ التحكم، وتبتسم لك على نحوٍ مشجِّع؛ فتضغط عشوائيًّا على أحد الأزرار، لتحدث المعجزة. فجأةً لا تسمع إلا فريقَ الوتريات في الأوركسترا الكبيرة، وهم يعزفون في تناغُم مثالي. ويتيح لك المزيدُ من الأزرار إضافةَ أو حذفَ آلاتٍ أو مجموعاتٍ موسيقية معيَّنة؛ مما يمكِّنك من تقدير دور كلٍّ منها على حدة أو في سياق وجودها مع غيرها؛ وبالتالي يتكوَّن لديك انطباعٌ تدريجي بأن الفوضى الظاهرية للمقطوعة ككلٍّ تتكوَّن من روابط ذات مغزًى بين آلات العزف المشاركة.
بالنسبة إلى الباحثين الذين يحاولون دراسةَ نشاز الخمسة والعشرين ألف جين أو أكثر الموجودة في الجينوم البشري، فإن مثل هذا الجهاز السحري للتحكُّم عن بُعْد سيكون الأداة المبتغاة؛ فعن طريق تنشيط الجينات أو تثبيطها سيتمكَّنون من تحديد كيفية تناغمها بعضها مع بعض.
قد لا تظل هذه الأداة حلمًا إلى الأبد؛ ففي محاولة أولى نحو إنتاجها، ابتكَرَ الباحثون — أو بالأحرى اشتقوا من الطبيعة — جزيئًا مُخمِدًا بوسعه إسكات آلاتٍ بعينها في الأوركسترا الجينومي. وعلى الرغم من أن إسكات جيناتٍ بعينها قد يبدو خطوة صغيرة، فإنه قد يحقِّق فعلًا عونًا كبيرًا في فهم التسلسل الجينومي، الذي يقدِّم قائمةً بالجينات دون تفاصيل عن الدور الذي تلعبه إجمالًا.
تقطيع الحمض النووي الريبي المشبوه

قبل أن تتجسَّد المعلوماتُ الموجودة في الجين على هيئة بروتين، لا بد من نَسْخ الجين إلى الحمض النووي الرسول. وعلى عكس بنية اللولب المزدوج الجديلة الشهيرة للحمض النووي، يكون جزيء الحمض النووي الريبي عادةً في صورة جديلة أحادية. (إن البنى الشعيرية التي تكوِّن بها الجديلةُ لولبًا مزدوجًا مع نفسها شائعةٌ في الحمض النووي الريبي البنائي، ولكنها غير مستحَبَّة بالمرة في الحمض النووي الرسول؛ إذ إنها ستمنعه من أداء وظيفته.) ولا يُعرَف عن الحمض النووي الريبي القابل للذوبان والمزدوج الجديلة أنه يوجد في مخزون الخلية الحية.
لكن في بعض الفيروسات، يوجد الحمض النووي الريبي المزدوج الجديلة بوصفه المادةَ الوراثية. لهذا، فإن العديد من الكائنات الحية — التي تتنوَّع ما بين النباتات وصولًا إلى ذبابة الفاكهة — تتمتع بآلية دفاعية تحفِّزها تحديدًا اللوالب المزدوجة للحمض النووي الريبي. وإذا رصدَتِ الآليةُ الدفاعية للخلية حمضًا نوويًّا ريبيًّا مزدوجَ الجديلة واشتبهت فيه، فإنها تقطِّعه إلى مقاطع قصيرة يبلغ طول كلٍّ منها حوالي ?? زوجًا قاعديًّا. ولأنها آلية عنيفة إلى حدٍّ ما ولا هوادةَ فيها، فإنها لن تبيد فقط هذه المقاطع عن بكرة أبيها، لكنها ستتخلص أيضًا من جميع جزيئات الحمض النووي الريبي الرسول التي تحمل التسلسلات المقابلة، على افتراض أن هذه الجزيئات الرسولة قد تكون نابعةً من الفيروسات نفسها.
في عام ????، حدَّدَت إيميلي بيرنشتاين وزملاؤها من معمل كولد سبرينج هاربور (في نيويورك) الإنزيم الذي يتعرَّف على الحمض النووي الريبي الدخيل ويقطِّعه في ذبابة الفاكهة «دروسوفيلا»، وقد اقتبسوا اسمَ هذا الإنزيم «القطَّاع» من اسم إحدى أدوات المطبخ. وخلال ذلك الوقت تقريبًا، فإن الآليةَ الدفاعية، التي كانت تُعرَف في السابق بأسماء مختلفة في مجموعات مختلفة من الكائنات الحية، أصبحت تُعرَف باسم تداخُل الحمض النووي الريبي، أو «آر إن إيه آي».
عند هذه المرحلة، لم يكن من الواضح بعدُ إن كانت الثدييات بدورها تستخدم هذه الآليةَ الدفاعية لمحاربة فيروسات الحمض النووي الريبي. وفي عام ????، أجاب توماس تشال وزملاؤه من معهد ماكس بلانك في جوتينجين بألمانيا عن هذا السؤال بتطبيق المعلومات التي حصلوا عليها من «الدروسوفيلا» على مستنبت خلوي ثديي، وفي نفس الوقت ابتكروا مُخمِدًا جينيًّا.
في حالة «الدروسوفيلا»، يقطِّع الإنزيمُ الحمضَ النووي الريبي المزدوج الجديلة إلى مقاطع تحتوي كلٌّ منها على ?? زوجًا قاعديًّا بالضبط، ولكي يتأكَّدَ فريق تشال من وجود آلية مماثلة لدى الثدييات من عدمه، خلَّقوا هذه المقاطع في المعمل واختاروا تسلسلاتها بحيث تتطابَق مع جين مُراسِل أدخلوه في جينوم مستنبتاتهم الخلوية، مثل الجين المسئول عن إنتاج إنزيم الوميض (اللوسيفريز) في اليراعات. في وجود ركيزة اللوسيفيرين، ستومض الخلايا الثديية المحتوية على هذا الجين مثل اليراعات. ومع هذا، عندما حقن الباحثون مقاطعهم المقابلة المكوَّنة من ?? زوجًا قاعديًّا من الحمض النووي الريبي داخل هذه الخلايا، توقَّفَ الوميض على نحوٍ قابل للقياس. وبالتالي، أثبتوا أمرين مهمين في تجربة واحدة؛ الأمر الأول: أن الخلايا الثديية تتمتَّع بمنظومة مماثلة تتعرَّف على الحمض النووي الريبي المزدوج الجديلة، وتثبط أيَّ جزيئات رسول مماثلة. والأمر الثاني: أنه يمكن استخدام المنظومة لإخماد جينات أخرى داخل الخلية بالإضافة إلى الجينات الفيروسية.
ولكن على وجه الدقة، كان جين اللوسيفريز المُراسِل دخيلًا غريبًا، مثله مثل الفيروس؛ لهذا أجرى فريق تشال تجربةً أخرى ليُثبِتوا إمكانيةَ إخماد جينات الخلية نفسها بنفس الطريقة. وبناءً على ذلك، استعان الباحثون بالخط الخلوي المستخرَج من ورمٍ لأحد المرضى المصابين بالسرطان، والمعروف باسم خلايا هيلا، وفي هذا المستنبت الخلوي استطاعوا أن يُخمِدوا بنجاح الجيناتِ المسئولةَ عن إنتاج بروتينين يوجدان عادةً في غشاء النواة.
تثبيط الجينات الطوعي

يبدو أن الآلية الدفاعية تعمل بطريقة متشابهة للغاية في الثدييات والحشرات. ومن المعايير المهمة لاستخدامها في الإخماد الجيني أنَّ مقاطِعَ الحمض النووي الريبي الصناعية يجب أن تكون أقصرَ من ?? زوجًا قاعديًّا؛ لأن المقاطع الأطول سوف تحفِّز أجهزةً دفاعيةً أخرى في الثدييات.
وبالتالي، فإن طريقةَ تداخُل الحمض النووي الريبي تتيح للباحثين أن يثبطوا طواعيةً أيَّ جين من جينات الجينوم البشري البالغ عددها ?? ألف جين. وبما أن الجينات التي ترتبط بعضها ببعض وتكوِّن عائلاتٍ جينيةً ستحمل في العادة أجزاءً من تسلسلاتها القاعدية المشتركة، فإنه من الممكن أيضًا إخمادُ مجموعات من الجينات. وعلى عكس الطريقة الأكثر بدائيةً التي تعتمد على إضافة الحمض النووي الريبي أو الحمض النووي «المشفَّر»، الذي هو عبارة عن مقطع أطول من الحمض النووي يعرقِل ببساطة الحمض النووي الريبي الرسول؛ فإن الطريقة الجديدة تتطلَّب أقلَّ من جزءٍ من الألف من المادة.
وهكذا، سرعان ما اتضحت فائدةُ أداة إخماد الجين الجديدة، حتى قبل الإلمام بتفاصيل طريقة استجابة الخلية لوجود الحمض النووي الريبي. ومثل تجربة الحفل الموسيقي التخيُّلية التي ذكرتُها سالفًا، فإن فهمنا للجينوم سيتحسَّن بفضل مساعدة المُخمِد.
(????)
أحدث التطورات

سرعان ما أثبتَتْ طريقةُ تداخُلِ الحمض النووي الريبي جدواها بوصفها أداةً ضرورية في أبحاث الجينوم. إلا أنه اتضح من خلال الأبحاث الإضافية في مجال الآليات الدفاعية أن الطبيعة قد ابتكَرَتْ وظيفةَ المُخمِد قبل أن يُعِيد البشرُ اكتشافَه بفترةٍ طويلةٍ؛ فأجزاء من جينومنا تُشفَّر تحديدًا لإنتاج مقاطع الحمض النووي الريبي التنظيمية، التي يُطلَق عليها اسم «إس آي آر إن إيه» (أو الحمض النووي الريبي الكابح الصغير)، والتي تحفِّز استجابةَ تداخل الحمض النووي الريبي، وبالتالي تكوِّن جزءًا مهمًّا من الشبكة التي يُنظِّم الجينوم نفسه بواسطتها.
في عام ????، فاز أندرو فاير من جامعة ماساتشوستس وكريج ميلو من جامعة ستانفورد بجائزة نوبل مناصَفةً في علم وظائف الأعضاء أو الطب لاكتشافهما طريقةَ تداخُل الحمض النووي الريبي.
قراءات إضافية

S. M. Elbashir et al., Nature, 2001, 411, 494.

الفصل السادس
من الحبر الإلكتروني إلى الورق الإلكتروني


لم تكن الشاشات التليفزيونية وشاشات الكمبيوتر الضخمة القديمة رائعةً بالمرة، وهي الآن تتراجع سريعًا أمام الشاشات المسطحة. ولكن هل يمكن أن تصبح الشاشات الإلكترونية مسطحةً ومَرِنةً مثل قطعة الورق؟ سيكون هذا رائعًا …
يُرجَى التفكير لبضع ثوانٍ في الورقة التي طُبِعت عليها هذه الكلمات. يا لها من نوعِ عرضٍ مفيد ومتعدِّد الاستعمالات! إنها رفيعة، وخفيفة، ومَرِنة، وقوية بصورة معقولة، يمكنك أن تقرأها في أي مكان، ويمكنك أن تحدِّد كلماتٍ معينةً أو تشطب عليها وتكتب تعليقاتك الخاصة بدلًا منها، ويمكنك أن تقطع الورقةَ لتحتفِظَ بالنص، أو أن تكوِّرها وتحاوِل أن تصوِّبها في سلة المهملات في الجانب الآخَر من الغرفة.
لكنَّ ثمة شيئًا واحدًا يعيبها؛ فبمجرد أن تَفرَغ من جميع الاستعمالات السابقة، تبقى الورقة في المكان الذي ألقيَتْها فيه، وتظل هدرًا للمكان وللموارد في المقام الأول، وحتى لو وضعتها في نهاية الأمر في حاويةِ إعادة التدوير، فإن إعادة إحيائها في صورة ورقة جديدة ستتطلَّب طاقةً. فَكِّرْ كَمْ سيكون الأمر أكثرَ سهولةً وحفاظًا على البيئة لو استطعْتَ أن تضغط بقلمك على أيقونة صغيرة في أسفل الصفحة، لتعرِض لك نفسُ الصفحةِ الملموسة الصفحةَ التالية من الكتاب، أو نصًّا آخَر. أو تخيَّلْ أنك انتهيْتَ توًّا من قراءة المجلد الأول من رواية هاري بوتر، فتنطق بالكلمات السحرية، وتفتح الكتاب من البداية مجدَّدًا، فتستطيع قراءة المجلد الثاني على نفس الصفحات.
تشير بعض التطورات الحديثة إلى أن هذه التصوُّرات الخيالية قد تتحقَّق في القريب العاجل. ففي عام ????، قدَّمَ فريق بقيادة جوزيف جاكوبسون من معهد ماساتشوستس للتكنولوجيا «حبرًا رحلانيًّا»، يمكن طباعته على أية مادة ويمكن تغييره بين المظهرين الأبيض والأسود بجهد كهربائي صغير. الحبر الإلكتروني «إي-إنك»، الذي يتم التسويق له من جانب شركة تحمل نفس الاسم (www.eink.com)، عبارة عن سائل يحتوي على كبسولات مجهرية، وتحتوي كلُّ كبسولة على صبغة بيضاء مشحونة في سائل أسود، وعندما تتعرَّض لمجال كهربائي، تتحرَّك الجسيمات البيضاء نحو الشحنةِ الموجبة، وتظل في هذا الجانب حتى تتعرَّض لمجال كهربائي له قطبية معاكسة. وعلى عكس شاشة العرض البلوري السائل «إل سي دي»، لا يتطلَّب هذا الحبر أيةَ طاقةٍ ليواصِل عرض البكسلات البيضاء أو السوداء. وحاليًّا خطَا فريق جون رودجرز من معامل بيل، بالتعاون مع شركة إي إينك، الخطوةَ التالية؛ فبدمج أحدث التقنيات في التصنيع المجهري، وأشباه الموصلات الغريبة، والحبر الإلكتروني، بنوا ما يمكن تسميته أول ورقة إلكترونية؛ شاشة سمكها ميلِّمتر واحد فقط، قابلة للانثناء، وتتسم بمظهر الورق.
يتمثَّل المبدأ الذي يتيح للقارئ أن يقلب الورقة إلكترونيًّا في ترتيبٍ بسيطٍ من الترانزستورات المرتَّبَة على شبكة من الإحداثيَّيْن السيني والصادي. ويشترط وجود ترانزستور واحد لكلِّ بكسل، والنموذجُ الأوليُّ من الورق الإلكتروني يحتوي على ??? منها: ?? صفًّا ? ?? بكسل. ويُحدَّد كلُّ بكسل بقطب كهربائي من الذهب يرتبط بمصرف الترانزستور الخاص به، ويمكن التعامل معه على نحوٍ مستقلٍّ بتعريض الترانزستور لجهد كهربائي صغير، بواسطة الروابط المناسبة التي تتلاءم مع الإحداثيَّيْن السيني والصادي المتعلِّقين به. ويستغرق تغييرُ الشاشة بأكملها حوالي ثانية واحدة.
إن التكنولوجيا الرئيسية المستخدَمة لإنتاج ترانزستوراتٍ قويةٍ على ركيزةٍ مَرِنة هي استخدام طباعة التلامس الميكروي، وهي تكنولوجيا «الطباعة الرقيقة» التي ابتكرها فريق جورج وايتسايدز من جامعة هارفرد. تنطوي هذه التكنولوجيا على «ختم مطاطيٍّ» مجهري الصُّنْع عادةً ما يكون مصنوعًا من مادة متعدد السيلوكسين ثنائي الميثيل التي تستطيع نقل الجزيئات العضوية ذات الطبقة الأحادية النموذجية إلى الركيزة. وفي هذه الحالة، تكون الركيزة عبارة عن طبقة من الذهب (?? نانومترًا) تقوم مقامَ طرفَي المنبع/المصرف في الترانزستور. وطباعة النمط المطلوب على الذهب تُؤمِّن له الحمايةَ في خطوة الحفر التالية، التي تنتج بواسطتها السمات المناسبة (نقاط تلامس المنبع والمصرف والأقطاب الكهربائية للبكسل).
لذا عندما تنظر إلى ورقة إلكترونية، فإنك تتعامَل مع قدر من الكيمياء أكثر مما ستجده في لباب الخشب العادي. بشكل إجمالي، توجد أولًا طبقةٌ شفافة من أكسيد قصدير الإنديوم الذي يعمل كقطب كهربائي تشترك فيه جميعُ البكسلات، ويعمل تعريض هذا القطب لشحنة موجبة على تحويل الشاشة بأكملها إلى اللون الأبيض، باستثناء البكسلات التي تتمتَّع بشاحنٍ أكبر على أقطابها الكهربائية المصنوعة من معدن الذهب. ثم يأتي دور الطبقة التي تتمتَّع بالكبسولات المجهرية للحبر الإلكتروني المشهور، تتبعها بنية الترانزستور: الأقطاب الكهربائية للذهب، والزجاج شبه الجُسيمي المصنوع من مركب «أورجانوسيلسكويكسان» العضوي الذي يقوم مقام العازل الكهربائي، والأقطاب الكهربائية للبوابة المصنوعة من أكسيد قصدير الإنديوم. وأخيرًا، في نهاية الصفحة بأكملها، توجد مادة زجاجية عادية؛ تريفثالات الأثيلين المتعدِّد التي تعمل كدعامة مَرِنة.
مع أن السُّمك الحالي أشبه بالورق المقوَّى أكثر منه بالورق العادي، فإن الانعكاسَ المنخفض للشاشة ودرجةَ وضوحها الشديدة يهدفان إلى إعطاء القارئ تأثيرًا شبيهًا بالورق تمامًا. تذكَّرْ فقط ألَّا ترميها في سلة إعادة التدوير.
(????)
أحدث التطورات

الورق الإلكتروني، مثله مثل الكتب الإلكترونية، من الأمور التي تبدو دائمًا وشيكةَ الحدوث. وفيما يبدو، فإن العديد من الشركات تتنافَسُ للتغلُّب على المعضلات المتبقية وطرح منتج صالح للبيع تجاريًّا. لكن حتى نوفمبر ????، فجميع الكتب والمجلات الموجودة في بيتي لم تزل بالورق القديم المصنوع من لباب الشجر (أو الورق القابل لإعادة التدوير).
قراءات إضافية

B. Comiskey et al., Nature, 1998, 394, 253.
Y. Xia and G. M. Whitesides, Angew. Chem. Int. Ed., 1998, 37, 551.
J. A. Rogers et al., Proc. Natl Acad. Sci. USA, 2001, 98, 4835.

الفصل السابع
دروس في الغَزْل


ربما تمتلك العناكبُ ثمانيَ أرجل مُشعِرة، ومخًّا صغيرًا للغاية، ومظهرًا قبيحًا، ولكنَّ ثمة شيئًا واحدًا على الأقل تجيد عمله أفضل منَّا، وهو تحديدًا إنتاج ألياف في منتهى القوة.
يتفوَّق مهندسو الطبيعة — بشتى الطرق — على مهندسي البشر. فسواءٌ نظرْتَ إلى الطرق التي تُصنِّع بها الداياتومات أو المحَّار أو الحلزونات أصدافَها، أو الطريقة التي تُغيِّر بها الفراشات ألوانَها، أو الطريقة التي تتحمَّل بها الأشجارُ الرياحَ القوية، فثمة درسٌ يمكن لمهندسي البشر تعلُّمُه دائمًا. وأحيانًا تكون هندسة الطبيعة مُتقَنة للغاية حتى إننا ما زلنا نواجِه صعوبةً في فهم كيفية عملها. ولكننا عندما نفهمها، تكون المكاسِب التي نجنيها من الدرس هائلةً.
من أروع الأمثلة عن كيفية تفوُّقِ الطبيعة علينا في أفضل مجهوداتنا خيوطُ العنكبوت الحريرية. ومثلما هو الحال مع شَعْر الإنسان وصوف الماعز والملابس الحريرية، فإن خيوط العنكبوت الحريرية تتكوَّن في معظمها من البروتين، ولكنَّ سلاسلَ متعدِّدِ الببتيدات تتوازَى وتتشابك بطرق عجيبة تجعل هذا المنتج أقوى من هذه المواد. فنظرًا لأن الطبيعة طوَّرَتْ هذه المادة بحيث تستطيع العناكِبُ أن تُوقِف حشرةً سريعة الطيران، تُعتبَر هذه المادة في الواقع أقوى مادة نعرفها من حيث وزنها، وإذا قارنْتَ خيطَ العنكبوت بسلكٍ فولاذيٍّ له نفس القُطْر، فستجد أنه يستطيع أن يحمل نفسَ الوزن تقريبًا، إلا أن الحريرَ أخفُّ منه ست مرات، وبالتالي فهو فعلًا أقوى من الفولاذ بست مرات، وسيربح العنكبوت في كل مرة.
إذن لماذا لا تزال الجسور المعلَّقة تتدلَّى على أسلاك الفولاذ بدلًا من خيوط الحرير؟ المشكلة أننا لا نستطيع أن نصنع خيوطَ العنكبوت الحريرية بنفس قدرة العنكبوت. إننا نستطيع بالتأكيد أن نعبِّر جينيًّا عن البروتينات التي يُصنَع منها في كائنات حية أخرى، بما في ذلك الماعز الذي سوف يتمتَّع ببروتين السبيدروين في ألبانه (والذي سأعاوِد الحديثَ عنه لاحقًا)، وسنكون قادرين قريبًا على غزل هذا الحرير إلى نوع من الألياف، ولكن نظرًا إلى فهمنا القاصر للعمليات التي تتم في غدَّة الحرير داخلَ العنكبوت، فربما لا تكون النتيجةُ مماثلةً للمنتَج الطبيعي.
يحاوِل فريق من علماء الأحياء بمجهوداتهم الفردية في معامل مختلفة حول العالم اكتشافَ سرِّ العناكب، وهم يحتاجون أولًا إلى الجينات الصحيحة. وحتى وقت قريب، لم يكن معروفًا سوى بضعة تسلسلات من الحمض النووي للجينات المسئولة عن إنتاج بروتين الحرير. في عام ????، قدَّمَ جون جاتسي وشيريل هاياشي مع زملائهما من جامعة وايومنج في مدينة لارامي نظرةً شاملة على التسلسلات الجينية لعدد هائل من الكائنات الثمانيةِ الأرجل المنتِجة للحرير، بما في ذلك العناكب الذئبية وغيرها من الحيوانات التي انفصلت عن «العناكب الحقيقية» منذ أكثر من ??? مليون عام. وقد أثبتوا أن تسلسلات الأحماض الأمينية تتنوَّع تنوُّعًا هائلًا بين السلالات، والصفة الوحيدة تقريبًا التي تشترك فيها جميعًا هي حدوث تسلسلات تكرارية غريبة تتبع أربعة أنماط بسيطة: البولي ألانين An، وصورة بديلة للجلايسين والألانين GA، واتحادات من الجلايسين ذات مجموعة فرعية صغيرة من الأحماض الأمينية X في وجود البرولين أو من دونه: GGX وGPGGX. بالنظر إلى أن هذه الصور قد احتُفِظ بها (أو تطوَّرَتْ على نحوٍ متقارِب) على مدار فترة زمنية تتخطَّى مائتَي مليون عام، فإن خواصها تحمل على الأرجح أدلةً مهمة حول الكيفية التي تتفاعل بها بروتينات الحرير لإنتاج الحرير. وحتى الآن، فإن المعلومات البنيوية الوحيدة التي نملكها تدور حول الحرير في صورته النهائية، حيث من المعروف أن التكرارات الغنية بالألانين تحدث في النطاقات شبه البلورية، في حين أن التكرارات الغنية بالجلايسين تتم في حالاتٍ أقل تنظيمًا يصعب فهمها.
يصنع العنكبوت من هذه الجينات البروتيناتِ الملائمةَ، المسمَّاة الفبروينات. ولا شيء مميَّز فيما يخص هذا الأمر؛ فالبروتينات يمكن أن يتكون منها الشعرَ والصوفَ ونوعَ الحرير الضعيف الذي تصنع الحشرات منه شرانقَها، إلا أن هذه الموادَّ ليست قويةً بما يكفي بالنسبة إلى العناكب. فلكي تصنع العناكب خيطَ البروتين المميَّز الأقوى من الفولاذ، فإنها تتمتَّع بغدة خاصة لإنتاج الحرير، وهي بنية معقَّدَة يُحوَّل فيها محلولُ البروتين بطريقةٍ سحريةٍ إلى خيط حريري. ومع أن هذا التحويل غيرُ مفهوم جيدًا حتى الآن، فمن المعروف أنه ينطوي على زيادةٍ كبيرةٍ في نسبة السلسلة البروتينية المنظمة في صورة صفائح بيتا مطوية.
في مقالٍ نُشِر عام ???? بمجلة «نيتشر»، لخَّصَ الأمرَ عالِما الحيوان فريتس فولرات وديفيد نايت اللذان كانَا يدرسان إنتاجَ الحرير في العنكبوت النسَّاج «نيفيلا كلافيبس» لعدة سنوات. أولًا: جديرٌ بالذكر أن هذه العناكب لا تملك نوعًا واحدًا من غدد الحرير، بل سبعة أزواج تنتج سبعةَ أنواع مختلفة من الحرير تصلح لمختلف الاستخدامات، ويُلاحَظ أيضًا أن التركيبَ البروتيني في هذه الغدد مختلِف اختلافًا ملحوظًا، والنوع الذي أمكن وصفه بدقةٍ هو حرير السَّحْب الذي تنتجه الغدةُ الأمبولية الرئيسية.
تتكوَّن هذه الغدة من ثلاث مناطق رئيسية: كيس مركزي (المنطقة ب)، يجاوره ذيل (المنطقة أ)، والمجرى (د) الذي يؤدِّي إلى المخرج (انظر الشكل ?-?). تحتوي بِطَانتَا المنطقتين (أ) و(ب) على الخلايا التي تفرز المادة البروتينية، التي يُعتبَر المكوِّن الأساسي فيها هو بروتين «???-كيه دي إيه» 275-kDa الذي يحتوي على البروتينَيْن المتعدِّدَيِ الببتيدات؛ سبيدروين ? وسبيدروين ?. تتخصَّص المنطقة (أ) في إنتاج بروتين السبيدروين، الذي يشكِّل اللبَّ القوي في الخيط، في حين يُعتقَد أن المنطقة (ب) تفرز مادة البروتين السكري غير المفهومة حتى الآن، التي ينتهي بها المطاف بتغليفها. ولكي تُفرَز البروتينات من الخلية، يجب أن تكون ملفوفةً في فقاعات غشائية تُسمَّى الحويصلات الإفرازية. وفي خلايا المنطقة (أ)، تحتوي هذه الحويصلات على خيوط بروتينية، وهو التكوين البنائي نفسه الذي لا يزال قيد الدراسة. أما حويصلات المنطقة (ب)، فإنها تحتوي على بلورات سائلة من طبقة البروتين السكري، ويعتقد نايت وفولرات أن الحالة البلورية السائلة تلعب دورًا مهمًّا في إنتاج خيوط الحرير، الذي سنعود إلى مناقشته لاحقًا. شكل ?-?: كيفية غزل العنكبوت لخيطه. يُفرَز المكوِّن البروتيني الرئيسي، وهو السبيدروين، في الغدة الأمبولية الشكل، المنطقة (ب). وتتغير خواصه المادية تغيُّرًا ملحوظًا خلال مروره عبر المجرى «إس».
دعونا نتتبع مسارَ جزيء السبيدروين منذ إفرازه وصولًا إلى الخيط في صورته النهائية. بمجرد مغادرة البروتين المقصود خلايا المنطقة (أ) (إذ تتَّحِد الحويصلات الإفرازية مع الغشاء الخلوي وتُفرِّغ محتوياتها خارجَه)، فإنه يجد نفسه في قطرة كروية صغيرة مع الكثير من جزيئات السبيدروين الأخرى، ويبلغ تركيز البروتين في الغدة بأكملها حوالي ???؛ أيْ أكثر من معظم البلورات البروتينية. تتكتَّل معظمُ البروتينات في كتل غير قابلة للذوبان بتركيزات أقل بكثير، وتتدفَّق هذه الكتلة البروتينية العالية اللزوجة نزولًا عبر ذيل المنطقة (أ) إلى الكيس (المنطقة ب)، حيث تُغلَّف بإفرازات خلايا المنطقة (ب). وعند مخرج الكيس، يمر السائل إلى المجرى الأضيق (ب)، وخلال هذا الانتقال، يتغيَّر شكلُ القطرات تدريجيًّا إلى أشكال رفيعة طويلة تتوازَى مع اتجاه التدفُّق. ومن المفترض حدوث تحوُّل مماثِل للجزيئات. في البداية، يجب أن تكون في بنية مضغوطة إلى حدٍّ ما لتجنُّب التكتُّل، ولكن مع انتقالها إلى المجرى، فإنها تتمدَّد وتتوازى بما يتيح في النهاية تشكيل تلك الروابط بين الجزيئية التي هي سبب تماسُكِ الخيط.
يكون معجون أو محلول الغزل وقتها في حالة بلورية سائلة، تصطفُّ فيها البروتينات بانتظامٍ، ولكنها لا تزال قادرة على الانزلاق بعضها إلى جانب بعض. ويُعتقَد أن هذا جزء مهم من السلاح السري للعنكبوت. وبينما تقل المادة تدريجيًّا وببطء في الساقين الأوليين من المجرى الثلاثي، يكون لدى الجزيئات الوقتُ لإعادة توجيه نفسها بطريقة مناسبة كي تستطيع في النهاية أن تكوِّن تفاعلاتِ صفائح بيتا بين الجزيئية، وربما روابط ثنائي الكبريتيد عندما يتعلَّق الأمر بإنتاج الخيط الفعلي. وتحدث هذه الخطوة عند نقطة على مسافة ? ملِّيمترات تقريبًا قبل المخرج، وعادةً ما تحدث فجأةً. ومع أن التفاصيل الجزيئية غير واضحة، فإنه يُعتقَد أنه مع خروج المعجون في صورة خيط رفيع ينفصل عن جدران المجرى، تتوازَى الجزيئاتُ أكثرَ وتكوِّن روابطَ هيدروجينية لتحدِّد أنماط صفائح بيتا المعقَّدة الموجودة في المنتج النهائي. وخلال هذه العملية، يصبح البروتين أكثر تجنُّبًا للماء ويطرد بعضًا من المحتوى المائي الذي كان يحمله حتى هذه المرحلة. وفي نهاية الأمر، يُطرَد معظم الماء من السطح عندما يترك الخيط سِدادة المخرج؛ مما يساعد العنكبوت في تفادي نقص الماء ويجعل خيطَه أقوى.
تجمع هذه الصورة العامة التي رسمها فولرات ونايت بين المعلومات التشريحية وبعض المعلومات البنيوية. ومع هذا، فإن التفاصيل الدقيقة للانتقالات البنيوية المهمة غير مفهومة بالمرة، وتكمن المشكلة في أن أقوى أدوات تحديد البِنى البروتينية، مثل تصوير البلورات بالأشعة السينية والرنين النووي المغناطيسي، تتطلَّب بلورات بروتينية أو محاليل متجانسة، على الترتيب. وحتى الآن، لا توجد طريقة يمكن أن تقدِّم البنيةَ التفصيلية الذرية لجزيء البروتين وهو يتدفَّق عبر مجرى غدة الحرير في العنكبوت.
ومع هذا، حتى في غياب الفهم التام بالمعنى الجزيئي، هل يمكن للمرء تقليد تقنية العنكبوت على مقياس ميكروسكوبي، عن طريق إمداد المعجون بالتركيب البروتيني المناسِب وتمريره عبر جهاز غزل مصمَّم على طريقة غدة العنكبوت؟ المادة المُخلَّقة الوحيدة المشابهة هي الأراميد (ألياف الكيفلار، وهي الألياف المستخدَمة في السترات الواقية من الرصاص)، وتُغزَل من حمض الكبريتيك الساخن؛ وبالتالي ستكون العملية التي تجري في درجة الحرارة المحيطة وتؤدي إلى إنتاج شيء مماثِل جذَّابةً للغاية، حتى إذا اتضح أن الألياف الناتجة بنفس جودة ألياف الكيفلار، وليست بنفس جودة حرير العنكبوت الحقيقي.
ولكن أولًا ستحتاج إلى إنتاج البروتينات بكميات معقولة. على عكس دودة القز، تتمتع العناكب بسلوكٍ مكاني عنيف؛ مما يعني أنها لن تتعاون مع فكرة إنشاء مزارع عالية الإنتاجية، كما أن التعبيرَ الجيني عن بروتينات الحرير في البكتيريا أو الخميرة غير ناجح بدوره؛ فالطبيعة التكرارية اللافتة للنظر في تسلسلاتها تحثُّ الميكروباتِ على اتخاذِ طرقٍ مختصرة وإنتاجِ نُسَخٍ مختصرة من السلاسل البروتينية.
بالتالي، إذا كنتَ ترغب في استخدام الحرير لاصطياد الطائرات المقاتلة بدلًا من الذباب، فحريٌّ بك أن تستعينَ بحيوان يستطيع إنتاج أكثر من بضعة ملِّيجرامات من هذه المادة الثمينة. كانت شركة نيكسيا بايوتكنولوجيز في مدينة مونتريال الكندية أول مَنْ ينجح في إنتاج ماعز مُعدَّل وراثيًّا بطريقةٍ تجعله يفرز بروتينَ السبيدروين في ألبانه. واتضح أن الخلايا الإفرازيةَ في الغدد الثديية لا تختلف كثيرًا عن خلايا غدد الحرير، الفارِق الوحيد أنه يوجد الكثير منها في الماعز؛ وهو ما يجعل حَلْب الماعز اقتصاديًّا أكثر من حَلْب العناكب.
منذ صيف عام ????، تباهَتْ شركة نيكسيا بامتلاكها ماعزتين قزمتين أفريقيتين، بيتر وويبستر، ثبَتَ أنهما تحملان جينَ العنكبوت المناسب. بعد استيلاد بضعة أجيال، سيوجد قطيع من الإناث التي تنتج السبيدروين في ألبانها بالجرام. بَيْدَ أن نيكسيا لم تحدِّدِ الطريقةَ التي تريد بها غزلَ بروتين الحرير-اللبن هذا في ألياف قوية بمقياس صناعي، لكن بمجرد أن تستطيع عمل ذلك، فإن المادة الجديدة ستدخل سريعًا في تطبيقاتٍ تتراوح ما بين الخيوط الجراحية وصولًا إلى الحماية من القذائف وأمن الطيران.
على الرغم من أن بعض التطبيقات المتصوَّرة مبالَغٌ فيها بصورة كبيرة مقارَنةً بشبكة العنكبوت، فثمة حالة من الاستهانة بها. ففي محاولةٍ لتحويل خيطٍ مرئيٍّ إلى سلك نانوي رفيع إلى حدٍّ يجعله غيرَ مرئي، جرَّدَ فريق بقيادة مايكل شتوك من معهد ماكس بلانك للكيمياء الفيزيائية الحيوية في جوتينجين حرير العنكبوت وصولًا إلى لُبِّه، باستخدام تقنية ليزر الأشعة فوق البنفسجية، فحصلوا على أسلاك نانوية في منتهى القوة، يبلغ قطرها حاليًّا ??? نانومتر. وتتضمن خططُ المستقبل تغليفَ هذا الخيط بالمعدن ليصير موصلًا.
لكن حتى عندما نستطيع محاكاة خيط العنكبوت واستخدامه بمقاييس طول متنوِّعة، فإن المفصليات الصغيرة المُشعِرة تظل متفوِّقةً. وحسبما أعلن ستيفان شولتس وزملاؤه من جامعة براونشفايج التقنية بألمانيا عام ????، فإن أنثى العنكبوت الاستوائي «كيوبيدينيوس سايلاي» تترك خيطًا مميزًا بالفيرومونات الجنسية، التي تحفِّز الذكر من نفس سلالتها لإصدار ذبذبات بحماسٍ، فتنتقل هذه الذبذبات عبر الخيط، الذي يتحوَّل فورًا من دور وعاء الرائحة إلى دور خط هاتف؛ فتُصدِر الأنثى بدورها ذبذباتٍ ردًّا على ذلك، ويمكنك أن تخمِّن بقية الأحداث بنفسك. وإنني لأتساءل ما إن كان أي شخص يريد أن ينشئ شركةً تعتمد على هذه التكنولوجيا …
(????)
أحدث التطورات

في نوفمبر ????، أجريْتُ مقابلة مع فريتس فولرات كجزء من بحثي لمقال رئيسي لمجلة «أكسفورد توداي»، واكتشفْتُ أن بعض الآمال المذكورة في المقال السابق لم تتحقَّق. وعلى وجه التحديد، فقد فشلَتْ محاولةُ إنتاج حرير العنكبوت الصناعي من بروتينات العنكبوت التي يُعبَّر عنها جينيًّا في لبن الماعز. وقد طوَّرَ فولرات وزملاؤه طرقًا لتحليل المعجون الحريري وللتنبؤ بما إذا كان سينتج الحرير المناسب، بَيْدَ أن الكائن الوحيد الذي يستطيع إنتاج حرير العنكبوت يظل هو العنكبوت نفسه. ويعتمد الأمل الحالي على المعالجة الجينية لمزيدٍ من الحيوانات «التي يمكن تكوين مزارع بها» مثل الفراشات، لحثِّها على إنتاج حرير العنكبوت بكميات كبيرة. وقد أعلن باحثون يابانيون بالفعل أنهم خدعوا يرقان دود القز لغزل شرانق تحتوي على ??? من حرير العنكبوت.
أما فيما يتعلَّق بالتطبيقات المحتمَلة، فآمال فولرات عريضة بخصوص المجالات الطبية البيولوجية، بما في ذلك علاج المفاصل. وبما أن بعض العناكب تستطيع إنتاجَ ستة أنواع مختلفة من الحرير لها خواص محدَّدة تصلح لمهامَّ معينة، فإنه يتعيَّن على العلماء ذات يومٍ أن يتمكَّنوا من تكييف المواد المُخلَّقة المشتقة من حرير العنكبوت مع متطلبات التطبيقات الجراحية.
قراءات إضافية

M. Papke et al., Angew. Chem. Int. Ed. 2000, 39, 4339.
J. Gatesy et al. Science, 2001, 291, 2603.
F. Vollrath and D. P. Knight, Nature, 2001, 410, 541.

الفصل الثامن
بروتينات إشارة المرور الجزيئية


لا بد أن نعتبر استخدامَ بروتين الفلورسنت الأخضر، أو ما يُعرف أيضًا بالبروتينات الفلورية الخضراء، بصفته واسمًا جينيًّا داخل الخلايا الحية؛ أحدَ أروع الابتكارات التي ظهرت خلال العقدين الماضيين. وعلاوةً على ذلك، فقد ظهر في بداية حياتي ككاتبٍ، وبالتالي تناولْتُ العمل الأصلي ثم جلستُ أشاهده يكبر ليصبح أحدَ أكبر الموضوعات على الإطلاق في البيولوجيا الجزيئية (انظر مقال «الشُّعلة الخضراء»). وبعد ذلك ببضع سنوات، اتسعت لوحة الألوان لتشمل ألوانًا مختلفة، وهو موضوع المقال التالي.
لقد انتشرَتْ تطبيقات بروتين الفلورسنت الأخضر المأخوذ من قنديل البحر «إيكوريا فيكتوريا» انتشارَ النار في الهشيم منذ البحث الصادر عام ????، الذي تحدَّثَ عن إمكانية استخدام بروتينات الفلورسنت الأخضر بصفتها واسِمًا في التعبير الجيني. ويمكن دمج الجين المسئول عن إنتاج بروتين الفلورسنت الأخضر — المتاح حاليًّا كأداة تجارية — مع جين محدَّد. وإذا تمَّ إنتاجُ بروتين الفلورسنت الأخضر، فسوف تلمع الخلايا باللون الأخضر تحت مصباح الأشعة فوق البنفسجية. يحدث الأمر بهذه البساطة، دون الحاجة إلى مواد كيميائية أخرى، ودون شروط. كما أظهر علماء الفيزياء الحيوية اهتمامًا كبيرًا بالجزء الصغير من البروتين الذي يبعث الضوء (حامِل اللون) بسبب بنيته الشديدة الغرابة التي تنشأ نتيجةَ تعديلاتٍ يُجرِيها البروتين على نفسه.
في عام ????، استنسَخَ الباحثون بروتينًا مماثِلًا لا يقلُّ عن بروتين الفلورسنت الأخضر إثارةً للاهتمام، هو DsRed، وحدَّدوا صفاته. هذا البروتين وثيقُ الصلة بالشِّعاب المرجانية ومأخوذ منها (من جنس «ديسكوسوما»)، ويشعُّ اللونَ الأحمر ويُعتبَر مسئولًا مسئوليةً جزئية عن المسحة الوردية اللون التي تميِّز الشِّعاب المرجانية. وفي عام ????، أجرى معمل رودجر تسين من جامعة كاليفورنيا في سان دييجو دراساتٍ تفصيلية، أظهرَتْ بعضَ المزايا والعيوب التي يتَّسِم بها هذا البروتين مقارَنةً ببروتين الفلورسنت الأخضر. مع أن تعديل بروتين الفلورسنت الأخضر يمكن أن يُنتِج العديدَ من الألوان، فإنه ما من صورة من صور بروتين الفلورسنت الأخضر تصل إلى نطاق الطول الموجي الخاص بالضوء الأحمر؛ وبالتالي فإن الانبعاث البالغ طوله ??? نانومترًا من بروتين DsRed يُعَدُّ اكتشافًا سارًّا للغاية لأي شخصٍ يريد أن يتمكَّنَ من استخدامِ واسِمات متعدِّدة ويرصد انبعاثاتها معًا. ويمكن لاستبدال بقية واحدة من الحمض الأميني أن يزيده إلى ??? نانومتر. ومثل بروتين الفلورسنت الأخضر، يكوِّن بروتين DsRed حامِلَ اللون الخاص به بالتحفيز الذاتي عن طريق دمج الحمض الأميني المجاور في حلقة إيميدازول، فيكوِّن في البداية بنيةً مماثِلةً لتلك التي يكوِّنها بروتينُ الفلورسنت الأخضر ثم يمددها ليحقِّق الانبعاثَ المميز ذا الطول الموجي الطويل. يحدث التفاعل الثاني ببطء شديد، وهو ما يمثِّل عائقًا أمام بعض التطبيقات، ولكن التفكير الإيجابي يمكن أن يحوِّل هذا العيبَ إلى ميزة، مثلما أوضَحَ أليكسي تيرسكيخ وزملاؤه من جامعة ستانفورد؛ فقد أنتجوا عمدًا نسخةً طافرة بطيئة التحوُّل من بروتين الفلورسنت الأحمر المماثِل، وأثبتوا أنها قد تكون مفيدةً بصفتها «ساعةً ميقاتية» في بيولوجيا النمو. وفي هذه التجارب، يكشف الضوء الأخضر الخلايا التي نشط فيها مؤخرًا الجينُ المطلوب، كما يُظهِر اللونُ المتدرجُ من الأصفر إلى البرتقالي نشاطًا متواصِلًا، في حين يشير الوميض الأحمر إلى أن الجين قد تمَّ تثبيطه.
ثمة عيبٌ آخَر محتمَل في بروتين DsRed، وهو أنه يحبُّ الارتباطَ في رباعيات وربما حتى في بنًى عليا قليلة الوحدات. لكن بالنظر إلى حجم التجارب التي أجراها الباحثون بواسطة بروتين الفلورسنت الأخضر المتماثِل، يمكننا أن نتوقَّع بأمان أنه عمَّا قريب ستوجد نُسَخٌ معدَّلة وراثيًّا من بروتين DsRed، أحادية وتنمو أسرع، وتلمع بكل تدرُّج يمكن تخيُّله للون الأحمر. وانتبِهْ إلى ضوء إشارة المرور الجزيئية الذي يتحوَّل من الأخضر إلى الأحمر بضغطة زر. (????)
أحدث التطورات

تُعتبَر واسِمات الفلورسنت على شاكلة بروتينات الفلورسنت الأخضر والأحمر مجالًا رائجًا في سوق أدوات المعامل حاليًّا، ولها العديد من النُّسَخ التي تسعى إلى جذب انتباه علماء البيولوجيا الجزيئية. وفي الواقع، فإنني لم أتابِعْ هذا التطورَ عن كثب أكثر، ولكن إذا كان ثمة أيُّ استخدامٍ لإشارات المرور الجزيئية، فأنا متأكِّد أن شخصًا يبيعها الآن بالفعل.
قراءات إضافية

L. A. Gross et al., Proc. Natl Acad. Sci. USA, 2000, 97, 11990.

الفصل التاسع
جزيء مُستقبِل رائع


الآن هذا المقال رائع بكل ما تحمله الكلمة من معنًى: اكتشاف جزيء مُستقبِل يستجيب لكلٍّ من المِنتول ودرجات الحرارة المنخفضة. إنه أمرٌ رائع!
من المثير للدهشة أن العلم لم يكتشِف الكثيرَ عن كيفية عمل حواسنا (باستثناء حاسة البصر المدروسة جيدًا) على المستوى الجزيئي. وعلى وجه التحديد، فإن الجزيئات المسئولة عن التذوُّق والإحساس بدرجةِ الحرارة لم تكن متاحةً للدراسة إلا منذ منتصف تسعينيات القرن العشرين، عندما منحَتْ تقنياتُ الاستنساخ الجزيئي بالإضافة إلى البحث عبر قاعدةِ بياناتِ الجينوم فرصةً أفضل للباحثين لتتبُّع هذه البروتينات الغشائية المحيِّرة والنادرة، واتضح أن ثمة علاقةً لافتة بين الإحساس ? «الحرارة» الذي يسبِّبه الفلفلُ الحار وذلك الذي تسبِّبه درجاتُ الحرارة المرتفعة؛ فكلاهما يحفِّزهما نفسُ المُستقبِل الغشائي، الذي استنسخه فريقٌ بقيادة ديفيد يوليوس من جامعة كاليفورنيا في سان فرانسيسكو عام ????، وأطلقوا عليه اسم «في آر ?» VR1 (نسبةً إلى النمط ? من مُستقبِلات الفانيلويد؛ إذ إن المكوِّن النَّشِط في الفلفل الحار، وهو الكابسيسين، ينتمي لعائلة الفانيلويدات). فيما بعدُ، طبَّق فريق يوليوس نفسَ المنطق الذي ساعَدَ في تحديد جزيء «في آر ?» باعتباره جزيئًا مُستقبِلًا للحرارة الشديدة الناتجة عن إحساس البرودة. وقد اختاروا مادةً كيميائية تحفِّز الإحساس بالبرودة، وهي المنتول، ثم حدَّدوا مجموعةً من الخلايا العصبية التي تستجيب لهذه المادة الكيميائية ولدرجات الحرارة الباردة. وفيما يبدو، فإن أداء مستنبتات العصب الثلاثي التوائم في الفئران يكون أفضل من خلايا عُقد الجذر الخلفي الظهرية المستخدَمة عادةً في مثل هذه الأبحاث. وباستخدام هذه الخلايا، وصفوا الخواصَّ الفسيولوجية للمستقبِل المزعوم حتى الآن، لكي يكتشفوا السبيل الأمثل إلى الإمساك به. وبَدَا أن الاستجابةَ إلى الإحساس بالبرودة يحفِّزها تدفُّقٌ خارجي للأيونات الموجبة الشحنة، بما في ذلك أيونات الكالسيوم التي تُعَدُّ أهمها على الإطلاق.
لهذا فحَصَ الباحثون الحمضَ النووي المُكمِّل (أيِ الحمض النووي المشتق من الحمض النووي الريبي الرسول الموجود في النسيج، الذي يمثِّل بالتالي الجيناتِ النَّشِطةَ) عن طريق استخدام تقنيات تصوير الكالسيوم للتأكُّد مما إنْ كانَتِ المستنبتات الخلوية التي تعبِّر عن أحد الأحماض النووية المكمِّلة قد استجابَتْ للمنتول أم لم تستجِبْ له. وحصل الباحثون على جزيء حمض نووي مكمِّل واحد منح خلاياه المضيفة استجابة تدفقية أيونية للبرد وللمنتول، وأيضًا للمركبين المُبردين: الأيسيلين واليوكاليبتول. وقد أثبتَتِ النتائجُ المُجمَّعة من مزيدٍ من الأبحاث في أنواع مختلفة من المستنبتات الخلوية أن البروتينَ الغشائي المشفَّر يتمتَّع بجميع الخواص المطلوبة لتفسير الاستجابة الفسيولوجية للخلايا العصبية الحسَّاسة للبرد التي بدأت الدراسة بها؛ ولهذا أُطلِق عليه النمط ? من مستقبِل المنتول-البرد، واختصارًا «سي إم آر ?» CMR1. اتضح أن «سي إم آر ?» بروتين غشائي مكوَّن من أكثر من ???? حمض أميني، بتسلسلات موسومة مماثِلة لمجموعة من القنوات الأيونية التي لم تُعرَف وظيفتها الفسيولوجية بعدُ، التي يُطلَق عليها قنوات «تي آر بي». لكن على عكس معظم هذه القنوات، فإن «سي إم آر ?» لا يحتوي على نطاق إنزيمي يتدلى من الجانب السيتوبلازمي للغشاء. وعندما فحص الباحثون الجينوم البشري بحثًا عن نُسَخٍ من المُستقبِل الجديد، اكتشفوا جينًا اسمه «تي آر بي-بي ?» trp-p8، كان يُعتقَد أنه يُعبَّر عنه تحديدًا من خلال ظهارة غدة البروستاتا السليمة وعدد من الأورام. وحتى الآن، لا يُعرَف إنْ كان هذا الجين يُعبَّر عنه أيضًا في الخلايا العصبية الحساسة للبرد لدى البشر، وبالتالي يصلح ليكون نظيرًا لبروتين «سي إم آر ?» الموجود في الفئران. في نفس الوقت، توصَّلَ فريق بحثي آخَر إلى نفس النتائج من اتجاه مختلف؛ فقد درس بيير وزملاؤه قنواتِ «تي آر بي» بهدف توضيح وظائفها الفسيولوجية. وبما أن كلًّا من مجسي الحرارة المعروفين «في آر إل ?» و«في آر إل ?» ينتميان إلى هذه العائلة أيضًا، فقد كان الإحساس بالبرودة فرضيةً معقولة يجب التأكُّد من صحتها. وحدَّدَ هذا الفريق نفسَ المُستقبِل، ولكنهم أطلقوا عليه اسم «تي آر بي إم ?» TRPM8. يستطيع بروتين «سي إم آر ?»، بالإضافة إلى مُستقبِلَي الحرارة هذين، أن يعمل كترمومتر فسيولوجي لنطاق درجات الحرارة الذي يتراوح ما بين ? درجات مئوية وحوالي ?? درجة مئوية، وذلك في معظمه وليس كله. ومن غير الواضح بعدُ إن كان يوجد المزيد من مُستقبِلات درجة الحرارة التي لم تُكتشَف بعدُ أو إنْ كانت توجد آليات غير معروفة حتى الآن قد تُعدِّل نطاق المُستقبِلات الثلاثة التي نعرفها. وبالمثل، فإن تفاصيل كيفية انتقال إشارات هذه المُستقبِلات ومعالجتها لم تُستكشَف بعدُ. والاكتشاف القائل بأنها جميعًا تنتمي لعائلة واحدة وتستجيب بنفس الطريقة تقريبًا قد يساهم في فهم الظواهر المتداخلة التفاعُل، مثل حقيقة أن الإحساس بالبرد القارس قد يشبه اللسعَ، والمفارَقةَ التي تنطوي على ألم اللسع الذي ينتج عن الاحتكاك بسطح ساخِنٍ وآخَر باردٍ في نفس الوقت. ومع اكتشاف الباحثين للجزيئات الرئيسية، اكتشفوا أخيرًا وسيلةً يتناولون بها الموضوعات المُلِحَّة المتعلِّقة بالإحساس بدرجات الحرارة.
(????)
أحدث التطورات

كشفت أبحاث لاحقة المزيدَ من المُستقبِلات المرشَّحة، بما في ذلك مُستقبِل للبرد الشديد (القارس). ولكي يوضِّح فريق يوليوس دورَ المُستقبِل الذي اكتشفوه، والذي يُطلَق عليه الآن عالميًّا اسمَ «تي آر بي إم ?»، أنتجوا سلالةً من الفئران المنتقصة جينيًّا بعد أن استأصلوا منها الجينَ المسئول عن إنتاج بروتين «تي آر بي إم ?» لدرجة أن البروتين الغشائي قد أُنتِج ولكنه لا يستطيع القيام بوظيفته كمُستقبِل. وفي الوقت نفسه، طبَّق فريقان آخَران على نحوٍ منفصِلٍ نفسَ المنهج.
أعلنَتِ الفِرَقُ الثلاث، التي نُشِرت نتائجُ أبحاثها في نفس الوقت عام ????، أن نقص بروتين «تي آر بي إم ?» يكبت استجابةَ الفأر للبرد المتوسط. وفي المستنبتات الخلوية للخلايا العصبية المأخوذة من الفئران المنتقصة جينيًّا، كُبِتَتِ الاستجابةُ للبرد أيضًا، في حين تعمل الاستجابةُ للحرارة على نحوٍ طبيعي.
اتضح أن الفئران المنتقصة جينيًّا طبيعيةٌ تمامًا، باستثناء ما يتعلَّق باستجابتها للاختلافات في درجات الحرارة. فالفئران الطبيعية تفضِّل سطحًا درجة حرارته ?? درجة مئوية عن السطح البارد، حتى لو كانت درجة حرارة السطح البارد ?? أو ?? درجة مئوية، حسبما يستطيع الباحثون أن يُثبِتوا عن طريق إجراء تجارب بسيطة للغاية يقيسون فيها المدةَ التي تختار هذه الفئران قضاءها لاستكشاف سطحين يبدوان متطابقين. أما الفئران التي تفتقر إلى جزيء «تي آر بي إم ?» نَشِط، فلم تفاضِلْ بين الأسطح التي تتراوح درجة حرارتها ما بين ?? و?? درجة مئوية، لكن بعدما قام الباحثون بتبريد المنطقة الباردة إلى ?? درجة مئوية، ثم إلى ?? درجات مئوية، أظهرَتِ الفئرانُ تفضيلًا بسيطًا وقويًّا، على التوالي، للمنطقة الأكثر دفئًا. وعندما وصلت درجة حرارة السطح إلى ? درجات مئوية، عاد سلوكها متماشيًا مع سلوك الفئران الطبيعية.
بناءً على ذلك، تُثبِت أبحاثُ الانتقاص الجيني، بالاتساق مع الدراسات البيولوجية الخلوية والجزيئية، أن الترمومتر البيولوجي في الفأر — الذي كان يُفترَض أنه مشابِه تمامًا لما لدى البشر — يميِّز بين نوعين من البرودة؛ فيوجد بردٌ مكروه قليلًا، يكون بروتين «تي آر بي إم ?» هو مجسه الأساسي، ويوجد البرد القارس الذي تقترب درجاتُ الحرارة فيه من نقطة التجمُّد، والذي له مُستقبِلات أخرى. ولم تُستكشَف بعدُ تفاصيلُ الآليات المستخدَمة والظواهر المتداخلة بين هذه النطاقات من سُلَّم الحرارة.
قراءات إضافية

D. D. McKemy et al., Nature, 2002, 416, 52.
A. M. Peier et al., Cell, 2002, 108, 705.
D. M. Bautista et al., Nature, 2007, 448, 204.
A. Dhaka et al., Neuron, 2007, 54, 371.
R. W. Colburn et al., Neuron, 2007, 54, 379.

الفصل العاشر
جزيئات التضاعُف تفقد مثبطاتها


من أروع ابتكارات تكنولوجيا النانو على الإطلاق اختراعُ أنابيب النانو الجزيئية من حلقات ببتيدية مصمَّمة بحث تتراص من تلقاء نفسها. وبما أنني قد وصفتُ هذا الابتكار بالتفصيل في مقال «مغامرات في عالم النانو»، فسأتناول تكنولوجيا ببتيدية مختلفة هنا، تأتي من نفس المعمل، وتحديدًا الببتيدات العصوية التي تحفِّز تكوينَ نفسها ذاتيًّا باستخدام مقطعين أقصر.
إذا أردتَ أن تحثَّ جزيئين على التفاعل، فإن توجيهَهما بالطريقة الصحيحة قد يحقِّق لك هذه الغايةَ بفاعلية. وبناءً على هذه المعلومة الكيميائية البسيطة وقدرٍ من التفكير الاستراتيجي الذكي، ابتكَرَ رضا غاديري وفريقه من معهد سكريبس البحثي (في لاهويا، بولاية كاليفورنيا) مجالًا بحثيًّا جديدًا تمامًا، وبدءًا من بنية بيولوجية موجودة بالفعل، وهي الشريط الملفوف (حلزونَا ألفا الملفوفان أحدهما حول الآخَر)، أعلنوا أن إحدى الجديلتين هي القالب الذي يساعِد في توجيه الجديلة الثانية، وهي ما يمكن أن نسمِّيها الجديلة المستهدفة. وقطعوا الجديلة المستهدفة إلى نصفين، ونشَّطوا الأطرافَ كي يستطيعَ النصفان التفاعُلَ لتكوين الجديلة الكاملة، ثم أثبتوا أن الجديلة القالب يمكن أن تعمل على توجيه النصفين، وبالتالي تسرِّع تفاعُلَهما لتكوين الجديلة المستهدفة الكاملة.
بهذه الطريقة أنتجوا إنزيمًا صناعيًّا جديدًا، وهو ليجاز الببتيد، الذي يستطيع تكوين ببتيد طويل من ببتيدَيْن قصيرَيْن. علاوة على ذلك، إذا كانت الجديلةُ المستهدفة مطابِقةً للجديلة القالب، فسيُنتِج التفاعُلُ المزيدَ من القوالب، وبالتالي يكون ذاتيَّ التحفيز. وبعبارة أخرى، أنتج الباحثون أولَ جزيء ذاتي التضاعف.
منذ ذلك الحين، أدخَلَ فريق غاديري مزيدًا من التطويرات على هذه الأداة الجزيئية ليبيِّنوا الكيفيةَ التي يمكن أن يطوِّر بها نظامٌ كيميائي بسيط بعضَ خصائص الحياة الأولية، مثل التضاعف وانتقاء عدم التناظُر المِرآتي وتصحيح الأخطاء والتفاعلات بين دورات التفاعل المتداخلة في دورةٍ فائقة معقَّدة.
شكل ??-?: الببتيدات الذاتية التضاعف.
طوَّر فريق جين شميلفسكي من جامعة بوردو نظامًا مماثِلًا خاصًّا بهم، ودمجوا وظائف تبديلية حسَّاسة لدرجة الحموضة أو لأيِّ معايير كيميائية أخرى؛ فكان ببتيد «إي ? إي ?» E1E2 الذي أنتجوه مثلًا يحتوي على «نوعٍ» حمضيٍّ من بقايا حمض الجلوتاميك بطول جانب واحد من الحلزون. وعند درجة حموضة متعادلة، تكون هذه السلاسل الجانبية مشحونةً بالكامل، وهو ما يجعل السلسلة الببتيدية تفضِّل البنيةَ غير المطوية. وعلى العكس من ذلك، فعند درجة حموضة منخفضة، تكون الببتيدات في أغلبها حلزونيةً ويمكن أن تعمل بمنزلة قوالب لتوجيه تخليق نفسها من المقطعين «إي ?» و«إي ?». لكن تكمن مشكلة هذا الأسلوب في أنه بمجرد حدوث التلاحم، يرتبط المنتَج بإحكامٍ مع «الإنزيم» أكثر مما فعل المقطعان الأصليان. وتعاني المنظومة من مشكلة تُدعَى تثبيطَ المنتَج؛ ولهذا السبب لا يزيد ناتجها باطراد مع مرور الوقت، مثلما قد يتوقَّع المرء في حالة نظام ذاتي التحفيز حقًّا.
للتغلُّب على هذه المشكلة الجوهرية، قلَّلَ فريق شميلفسكي استقرارَ مركب الشريط الملفوف بقدر ما يستطيعون دون تهديدِ ارتباط المقاطع اللازم لعملية التوجيه. وقد حقَّقوا هذا الهدفَ بتقصير الببتيد «إي ? إي ?» الذاتي التضاعُف ليبلغ طوله ?? من بقايا الحمض النووي، وهو الرقم الذي كانوا يعتقدون أنه الحد الأدنى لحدوث التفاعل المطلوب. وبدراسة قدرة الببتيد الجديد — المسمَّى «آر آي-??» RI-26 — على التضاعف الذاتي، لاحظوا كفاءةً تحفيزية (ثابت معدَّل التحفيز/ثابت معدَّل عدم التحليل) مقدارها ??? ألف، وهذا يزيد بمقدار عشرين ضعفًا عن الرقم السابق المسجَّل للجزيئات الذاتية التضاعف. وتقترب هذه الكفاءة من النطاق الموجود في الإنزيمات الطبيعية. بناءً على هذه النتائج، وملاحظة مؤشرات حركية أخرى، استنتَجَ الباحثون أنهم قد نجحوا لأول مرة في فكِّ شفرةِ تثبيط المنتج في الببتيدات الذاتية التضاعف. ومع أن الفريق الذي كان يقوده جانتر فون كيدروفسكي من جامعة فرايبورج بألمانيا قد ابتكَرَ أحماضًا نووية ذاتية التضاعف وتغلَّبوا على هذه المشكلة بتدوير درجة الحرارة (بصفة أساسية مثلما في تفاعُل البوليميراز المتسلسل)، فمن الواضح أن عدم استقرار المركب المكوَّن من القالب والمنتَج هو أكثر الطرق الواعِدة للتوصُّل إلى نظام حقيقي ذاتي التضاعف يمكن أن يعمل بانتظامٍ في الظروف البيئية الثابتة.
تتوافر هذه الببتيدات بكثرةٍ، ومن ثمَّ توجد فرصةٌ فريدة لدراسة «السلوك» الجزيئي المعقَّد في منظومة بسيطة، وستكون بعض العمليات المشتركة حافلةً على نحوٍ غريب بأمورٍ تحدث داخل الخلية الحية. على سبيل المثال، أعلن فريق غاديري ظهورَ «التعايُش» خلال تجاربهم المبكرة التي نفَّذوها على الدورات الفائقة للببتيدات. ومع هذا، يجب ألا يتشجَّع المرءُ على نقل هذه النتائج إلى المجال الذي لا يزال غامضًا والمتعلِّقِ بأصل الحياة وتطوُّرها قبل الخلوي. يجب التأكيد على أن الجزيئات البيولوجية لا تضاعِف نفسها، وإنما تضاعِف بعضها بعضًا؛ وعلاوة على هذا، فإن معظم الباحثين يرون الحمضَ النووي الريبي باعتباره المرشحَ الأكبر للدور الرئيسي في المراحل الجزيئية المبكرة من التطور. وبالتالي، قد لا تُعلِمنا الببتيدات الذاتية التضاعف الكثيرَ حول جذور شجرة الحياة، ولكنها تضيف بعضَ الفروع الجديدة المثيرة إلى شجرة الكيمياء.
(????)
أحدث التطورات

ظلَّ هذا المجال بعيدًا عن الأنظار على نحوٍ مخيفٍ خلال السنوات القليلة الماضية، ولكني آمل أن يعود إلى بؤرة الاهتمام قريبًا.
قراءات إضافية

D. H. Lee et al., Nature, 1997, 390, 591.
A. Luther et al., Nature, 1998, 396, 245.
R. Issac et al., Curr. Opin. Struct. Biol., 2001, 11, 458.
R. Issac and J. Chmielewski, J. Am. Chem. Soc., 2002, 124, 6808.

الفصل الحادي عشر
الإلكترونيات البيولوجية: تصادُم قاري


في عام ????، شاركتُ في تأليف كتاب يتحدَّث عن الكيفية التي بدأ بها عالَمَا الإلكترونيات والبيولوجيا في الاندماج؛ إذ اكتشف الباحثون كيفيةَ ربط الترانزستورات بالخلايا العصبية، أو ربط شبكة العين الصناعية بالقشرة الدماغية البصرية. كان الكتاب باللغة الألمانية، وسرعان ما تعرَّضَ للمشاكل؛ إذ طالبَتْ إحدى الشركات بحقوق ملكية العلامة التجارية للمرادف الألماني لكلمة «الإلكترونيات البيولوجية». لهذا، على مدار عامين حتى حُسِمت تلك المشكلة القانونية، ظلَّ المقال التالي — الذي كُتِب لمجلة «بايو-آي تي وورلد» كاشتقاقٍ من الكتاب — مصدر الشرح الوحيد لفكرة الإلكترونيات البيولوجية في النطاق العام.
إنَّ الأحياء علمٌ ثري ومتنوِّع، ويتفرَّع في العديد من الاتجاهات ويشترك في العديد من التخصُّصات الأخرى مع مجالات بحثية متداخلة المناهج. وإلى جانب مجالَي الكيمياء الحيوية والفيزياء الحيوية القديمين والمهيبين، توجد إضافات عصرية وجديدة، مثل علم الأحياء الفلكي وعلم الأحياء الاجتماعي. وفيما يبدو، فإن عددًا متزايدًا من المجالات الجديدة يعتمد على العناصر التي يشاركها علم الأحياء مع الإلكترونيات وتكنولوجيا المعلومات. وأودُّ أن أقول إن هذا التطوُّرَ ليس مجرد اتجاه حديث، وإنه يعكس عمليةَ دمج فعلية بين عالَمَيِ المعالجة المعلوماتية البيولوجية والتكنولوجية. ونلاحظ تصادُمًا قاريًّا بين العالَمَين سيجعل الفواصلَ بينهما تختفي ويخلق مجالاتٍ جديدةً تمامًا.
من وجهة النظر التقليدية العامة التي توارثناها على مدار أجيال عديدة، فإن المنظومتين الطبيعية والتكنولوجية متعارِضتان تمامًا ولا مجال للتداخل بينهما. ولطالما صمَّمَ الناس أدواتٍ مستوحاةً من الطبيعة، بدايةً من الروافع وحتى الكاميرات، إلا أن الأجهزة التكنولوجية حقَّقَتْ أهدافها بطرقٍ مختلفة عن نظيرتها الطبيعية. وحتى اليوم، لا يوجد كمبيوتر يعمل مثل عقل الإنسان، ولا ميكروفون يعمل مثل الأذن، ولا كاميرا تعمل مثل العين. وفي موروثنا الثقافي، مَنِ انتهكوا هذا الحد الفاصل — ولعل أشهرهم الدكتور فرانكنشتاين — لاقَوا عقابهم.
مع ذلك، تعمل التطورات الحالية على إزالة هذا الحد الفاصل تدريجيًّا، ويبدو أنه خلال عشر سنوات لن يكون له وجود مطلقًا؛ فالفواصل تتآكل من كلا الجانبين. تستوحي التكنولوجيا أفكارًا من علم الأحياء الخلوي أكثر من ذي قبل، ويعتمد مجال تكنولوجيا النانو بأكمله على فكرة أن آليات الخلية تعمل بمقياس النانومتر. ومن ثمَّ، يطرح علماء تكنولوجيا النانو السؤال المحوري التالي: لماذا لا نبني آلاتٍ بهذا المقياس أيضًا؟ فبتصغير مقياس التكنولوجيا وصولًا إلى المقياس الخلوي، يمكننا أن نتبع خطى الطبيعة عن كثب إلى حدٍّ ما. على سبيل المثال، يمكننا أن نستعير آلات جاهزة — مثل المحركات الجزيئية — من الخلية ونستخدمها لأغراضنا الخاصة، أو يمكننا بدلًا من ذلك أن نطبِّق مبدأَ تصميم الآلات من البروتينات، ولكن بتصميمنا الخاص.
وحتى إذا استخدمنا جزيئاتنا (الصناعية) الخاصة، مثل الدندريمر أو الروتاكسينز، فإننا لا نزال في هذه الحالة نستخدم مبادئ البنية البيولوجية، مثل أفكار التركيب الذاتي، أو التفاعلات الضعيفة (اللاتساهمية)، أو التصميم المعياري، أو تكوين مركب تدريجي معقَّد من عناصر أساسية بسيطة. وعلى أية حال، فإن الوسائل التكنولوجية المستقبلية التي ستحقِّق حلمَ مقياس النانو سوف تحتوي على بعض العناصر ذات الأصل البيولوجي.
على الجانب الآخَر من هذا الفصل التقليدي بين المجالين، فإن فهم ما يدور داخل الخلية الحية قد تطوَّرَ على نحوٍ هائلٍ على مدار الخمسين عامًا الماضية، وبعض الجوانب التي ظهرت بمقياس النانو تشبه وسائلنا التكنولوجية القديمة ذات المقياس الكبير؛ فالخلية تحتوي على محركاتٍ دورانية وخطيَّة، وخطوطِ تجميع وتفكيك جزيئية، ومضخاتٍ ولوحاتِ مفاتيح، والعديد من الأشياء المفيدة الأخرى، حتى إن بعضها يحتوي على خلايا شمسية أو مصابيح ضوئية أو ساعات. وبحسب الطرق التي تخزِّن بها كلُّ خليةٍ المعلوماتِ وتعالجها، فإن كلًّا منها يتمتَّع ببعض سمات الكمبيوتر المتناهي الصِّغَر.
كلما فهمنا الجوانب الآلية للخلية وتعلَّمنا حُسنَ استغلال العناصر البيولوجية في وسائلنا التكنولوجية، أصبح من الأيسر تكوين مجالات مشتركة جديدة تجمع بين الجانبين. في الوقت الحالي، من الممكن بالفعل زرعُ شبكيةِ عينٍ صناعية بدائية داخل عين الإنسان وربطها بالجهاز العصبي للمريض المستفيد من عملية الزرع، وذلك بطريقة تتيح له فعلًا الرؤيةَ بصورة طبيعية. وفي بحث حديث مثير للجدل إلى حدٍّ ما، استطاع علماء من جامعة ولاية نيويورك إدخالَ جهاز تحكُّمٍ عن بُعد في الجهاز العصبي المركزي لفأر، لينتجوا «فأرًا آليًّا» يوجِّهون تحرُّكاته عن طريق رسائل اتصال مباشِرة صادرة من الكمبيوتر إلى المخ.
مع أن شبح الخوف من حادثة سوء الاستغلال التي وقع فيها فرانكنشتاين لا يفارقنا أبدًا عندما يتعلَّق الأمر بربط أسلاك بالخلايا الحية، فثمة العديد من المزايا التي لا جدال فيها، والتي يمكن أن تنبع من القدرة على تكوين حلقات وصل بين الخلايا العصبية والإلكترونيات التقليدية؛ فالمصابون بالشلل السفلي سيتعلمون السيرَ، والصُّمُّ سيسمعون، والعميان سيرون، بشرط توصيل تلك الأسلاك بأدمغتهم بالطريقة المناسبة.
أما خارج الجسم، فإن الاتجاه الخاص ? «الحاسبات القابلة للارتداء» قد أنتج أدواتٍ لتكنولوجيا المعلومات يمكن أن تُركَّب في النظارات أو في الثياب. ومع أن هذا المجال قد ظلَّ حتى الآن ملعبًا لمهووسي العلم، فإنه ليس من الصعب التنبؤ بأن بعض التطبيقات الطبية المفيدة بحقٍّ يمكن أن تُنتَج بمجرد ابتكار أجهزةٍ قابلةٍ للارتداء ميسورةِ التكلفة (سواء أكانت قابلةً للارتداء تحت الجلد أم فوقه) لتتفاعل مع وظائف جسم الإنسان بطريقةٍ ذات معنًى. ومن الأجهزة المرشَّحة الواعدة موزِّعُ الأنسولين/مستشعر الجلوكوز المشترك للمرضى المصابين بالسكر، وهو ما يمكن أن يصبح متاحًا في غضون بضع سنوات.
في مجال تكنولوجيا المعلومات، فإننا نلمس بالفعل مزايا الاندماج مع علم الأحياء، ومن المتوقَّع أن يظهر المزيد منها في المستقبل القريب؛ فالانفجار الحالي في المعلومات الجينومية لم يكن ليصبح متاحًا دون أجهزة الكمبيوتر الموجودة اليوم، بل إنه يدفع أيضًا إلى تطور تكنولوجيا المعلومات في بعض المجالات. وعلى الجانب الآخَر، فمن المتوقَّع أن النمو المطرد في أداء أجهزة الكمبيوتر الذي تنبَّأ به قانونُ مور سوف يتغلَّب على العقبة الأخيرة في وقتٍ ما خلال العقد القادم، وتُعتبَر الجزيئات الحيوية من بين المرشحين الواعدين لمزيد من التطوير.
في المستقبل غير البعيد، قد تُستخدَم مع المرضى أجهزةٌ طبية بالكاد تكون مرئيةً، قد تستعين بالجزيئات الحيوية كمستشعراتٍ، ثم بعض الأجهزة الإلكترونية التقليدية لمعالجة المعلومات، ثم أخيرًا الكيمياء من أجل التشغيل. وسيُحسَّن أداءُ تلك الأجهزة ككلٍّ بحيث لا يتعرَّف عليها الجهازُ المناعي للمستفيد باعتباره جسمًا دخيلًا. وعند هذه المرحلة، لن يكون من المنطقي بعد ذلك تحديدُ الأجزاء البيولوجية والتكنولوجية من هذه الأجهزة؛ إذ سيكون الأمرُ أشبهَ باندماج قارتين لتكوين قارة واحدة.
(????)
أحدث التطورات

في عام ????، استطاع الباحثون ربطَ الأسلاك النانوية بالخلايا العصبية، مثلما سأصف لاحقًا (انظر مقال «إدخال الأسلاك النانوية إلى الخلايا العصبية»).

الفصل الثاني عشر
الكمبيوتر الكمِّيُّ الأحادي الذرة


خلال أيام عملي في معمل أكسفورد، كنتُ أشارك غرفةَ الكمبيوتر جوناثان جونز، زميلي الذي كان يشترك في مشروعات المعمل البحثية الرئيسية، وكان يدير بالإضافة إلى ذلك مشروعًا جانبيًّا بَدَا أنه ينطوي على عمليات حسابية من قبيل ? + ?. وسألته ذات يومٍ عن مشروعه، فشرح لي أنه يصمِّم كمبيوترًا كميًّا يعتمد على الجزيئات العضوية الصغيرة التي تُفحَص بواسطة جهاز الرنين النووي المغناطيسي (التي كانت متوافرة بكثرة في الأرجاء). وبفضل شرح جوناثان، فهمت جزءًا صغيرًا من التصوُّر الكلي لمشروع الكمبيوتر الكمي، بما يكفي لكتابة مقالات عنه من آنٍ إلى آخَر، وكانت جميعها مقالات ممتعة، لكني اخترت المقال التالي لأنه ظهر مع فقرتي الافتتاحية المفضَّلة:ذرة كالسيوم واحدة ? إلكترون واحد = كمبيوتر كمي واحد
راجع المعادلة مايكل جروس لقد كتب الفيزيائيون النظريُّون العديدَ من المقالات والكتب الكاملة عن الأمور الرائعة التي يمكن للمرء أن يحقِّقَها بواسطة الكمبيوتر الكمي. يوجد العديد من المسائل الحسابية المهمة التي تُصنَّف حاليًّا باعتبارها «مستعصيةَ الحل» لأن الوقت المستغرَق في إجراء العملية الحسابية يتضاعف أسيًّا مع زيادة عدد المتغيرات، وبالتالي يصبح التوقيت فلكيًّا بسرعة شديدة. سيكون الكمبيوتر الكمي الضخم قادرًا على حلِّ مثل هذه المسائل، بفضل الخواص المميزة التي تتيح للبِت الميكانيكي الكمي الواحد (الكيوبِت) أن يكوِّن الحالتين ? و? في وقت واحد. ثمة عيب بسيط يتمثَّل في أن جميع طرق التشفير المستخدَمة اليوم في العديد من المجالات، بدايةً من المعاملات البنكية عبر الإنترنت ووصولًا إلى الاتصالات العسكرية، لن تكون آمنةً بعد الآن. ولكن، في مقابل ذلك، سيتيح لنا التشفير الكمي نوعًا جديدًا من التشفير تضمن سريَّتَه قوانينُ الفيزياء؛ وبالتالي ستكون كل الأمور في نصابها، وهذا ما تؤكِّده الناحيةُ النظرية على الأقل.
أما هنا، على أرض الواقع، فقد بلغت أجهزة الكمبيوتر الكمية عام ???? مرحلة حيوية في مستهلِّ مراحل تطوُّرها، وهو ما يضاهي في تاريخ الكمبيوتر مرحلةَ اختراع الترانزستور. أُنتِج البِت الكمي الفعلي بالعديد من الطرق المختلفة، ويكمن التحدِّي الآن في تطويعه لإجراء العمليات الحسابية المستعصية. منذ خمس سنوات، كانت هناك تجربة رائدة باستخدام المِنظار الطيفي بالرنين النووي المغناطيسي المتاح تجاريًّا لملاحظة اللفات النووية لذراتٍ معيَّنةٍ في جزيئات صغيرة والتلاعُب بها، وقد نجحت هذه التجربة في نقل الخوارزميات الكمية من حيِّز النظرية إلى حيِّز التطبيق.
لكن سرعان ما اتضح أن هذه التقنية غير مناسبة عند مستوى آلاف الوحدات من البِت الكمي، في حين يمكن أن يصبح الكمبيوتر الكمي مفيدًا ويُثبِت تفوُّقَه على أجهزة الكمبيوتر التقليدية. لهذا السبب، تحمَّسَ الخبراء الذين التقوا في اجتماعٍ نقاشيٍّ بالجمعية الملكية في نوفمبر ???? عندما سمعوا من رينر بلات أن فريقه من جامعة إنزبروك في النمسا قد تمكَّنَ من تنفيذ خوارزمية كميَّة بواسطة وحدتين من البِت الكمي، مستعينين بأيون كالسيوم واحد محتجز باعتباره جهازَ الكمبيوتر. وبينما تعتمد طرق الرنين النووي المغناطيسي على ملاحظة التجمعات الجزيئية التي تنتشر في أنبوب الرنين النووي المغناطيسي العادي، تمثِّل تجربة إنزبروك أولَ عملية حسابية كمية تُنفَّذ على نظامٍ يخضع بالكامل لسيطرة القائمين بالتجربة.
من الصعب للغاية التفكيرُ في مسألة حسابية يمكن حلها باستخدام وحدتَيْ بِت فقط من المعلومات، والأصعب من ذلك هو التفكير في مسألةٍ بهذا الحجم يمكن حلُّها بخطوات أقل على كمبيوتر كمي بدلًا من الكمبيوتر العادي. ثمة بعض من هذه المسائل، وقلة قليلة من الخوارزميات الكمية البسيطة التي يحاول الباحثون تنفيذها على أجهزة الكمبيوتر الكمية، وربما تكون المسألة الألمانية هي الأكثر دراسةً من بين هذه المسائل، وقد استُخدِمت في الأبحاث الرائدة لكلٍّ من الرنين النووي المغناطيسي والحوسبة الكمية باستخدام الأيونات المحتجزة. والمهمة هي تحديد إن كان الأمران متشابهين أم مختلفين، بافتراض أن كلًّا منهما يمكن أن يكون في إحدى حالتين فقط.
تخيَّلْ أنك تريد التأكُّد مما إن كانت الأنوار في غرفة نومك وفي الحمام على نفس الحالة (كلا المكانين مضاء، على سبيل المثال). سيتعيَّن عليك الذهاب إلى كلتا الغرفتين وملاحظة حالة الإضاءة في كلٍّ منهما، ثم مقارنة النتائج، ويمكنك حينئذٍ أن تعترض بأن في الأمر عناءً كبيرًا، لأنك تسعى إلى وحدة بِت واحدة فقط من المعلومات. وبما أن الأنوار يمكن أن تكون في نفس الحالة أو في حالة مختلفة، فثمة احتمالان فقط، وبالتالي فإن إجابة السؤال تتضمن المحتوى المعلوماتي لوحدة بِت واحدة. ولكن في الفيزياء التقليدية، لا مهربَ من حقيقة أنك مضطر إلى جمع وحدتَيْ بِت من المعلومات (حالة الإضاءة في كلِّ غرفة من الغرفتين، الأمر الذي لا يعنيك حقًّا)، ومقارنة الحالتين، واستنتاج نتيجة بت واحدة من هذه المقارنة.
أثبَتَ ديفيد دويتش، عالِم الفيزياء من جامعة أكسفورد ورائد الحوسبة الكمية ومروِّج تفسير ميكانيكا الكم للأكوان المتعدِّدة، أنه على النقيض مما سبق فإن الكمبيوتر الكمي يمكن أن يتوصَّل إلى هذه النتيجة في خطوة واحدة دون جمع وحدات البت غير المرغوبة من المعلومات. ومن الخوارزميات الكمية التي تستطيع إجراء مثل هذه العملية الحسابية المتعلِّقة بإثبات «التماثل أو الاختلاف» خوارزميةُ دويتش-جوزا، التي طبَّقها بالفعل فريقُ بلات باستخدام أيون كالسيوم واحد. احتجَزَ باحثو إنزبروك أيون الكالسيوم 40Ca+ باستخدام التبريد بالليزر (في جهاز يُعرَف باسم مصيدة بول)، ثم استعانوا بحركته الاهتزازية وحالة الإثارة التي يتعرَّض لها الإلكترون الوحيد المتبقِّي في الغلاف الخارجي (الذي سيتم التخلُّص منه في أيون الكالسيوم Ca2+ المعروف، الذي يُعتبَر مفيدًا لصحة العظام والأسنان) باعتبارهما وحدتَي البِت الكميتين. وللتعامل معهما، استعانوا بنبضات الليزر ذات الأطوال الموجية المحدَّدة، ولتحسين التحكُّم في نظامهما استعانوا أيضًا بطرق تنطوي على النبضات المركبة، التي طُوِّرت لأول مرة من أجل نبضات الترددات اللاسلكية المستخدَمة في الرنين النووي المغناطيسي. الموثوقية والقوة النسبية التي لاحظهما فريق بلات في ذلك النظام الأحادي الأيون تشيران إلى أنه في المستقبل القريب يمكن تعديل حجمه ليضم عدة ذرات، ربما أيضًا من أنواع مختلفة. وقد يكون الطريق طويلًا للانتقال من التحكُّم في ذرة واحدة إلى التحكُّم في أكثر من ذرة، إلا أنه إذا أُتِيحت أجهزةُ كمبيوتر كمية بأعدادٍ هائلة من وحدات البِت الكمية، فستكون النتائج مُبهِرةً حقًّا، ليس من الناحية النظرية فحسب.
(????)
أحدث التطورات

شهد مجال الحوسبة الكمية تقدُّمًا بطيئًا بصفة عامة، ولكن في سبتمبر ???? تقدَّمت أجهزة الكمبيوتر الكمية الفعلية خطوة للأمام؛ فقد أعلن فريقان بحثيان أن فوتونات معينة يمكن إنتاجُها في شريحة مجهرية، بحيث تتبادل المعلومات الكمية عبر دوائر فائقة التوصيل. وتتوافق هذه النتائج مع ما يشير إليه غلاف مجلة «نيتشر» (عدد ?? سبتمبر ????) باعتباره «الحافلة الكمية». وبما أن هذا الإنجازَ معتمِدٌ على وسائل تصنيع نانوي قائمة بالفعل، فيجب أن يكون هدفه نسبيًّا أن يزيد إلى وحدات بِت متعددة، وربما إلى أجهزة متعددة تُنتَج على نطاق واسع.
قراءات إضافية

C. H. Bennett and D. P. DiVincenzo, Nature, 2000, 404, 247.
S. Gulde et al., Nature, 2003, 421, 48.
M. A. Sillanp?? et al., Nature, 2007, 449, 438.
J. Majer et al., Nature, 2007, 449, 443.

الفصل الثالث عشر
الْتِوَاء ودوران


بصفتي شخصًا عمل مع الجزيئات البيولوجية لعدة سنوات، فإني أتفهَّم الإحباطَ الناجم عن حقيقة أن هذه الجزيئات تكون في العادة غير مرئية وغير ملموسة. ولا بد أن كلَّ مَن تعامَلَ مع البروتينات أو الأحماض النووية قد تمنَّى في مرحلةٍ ما أن يكون قادرًا على أن يشدَّ طرفَي البوليمر البيولوجي ويمزِّقه، أو يلويه في هذا الاتجاه أو ذاك. ومنذ بضع سنوات، تحوَّلَ هذا الحلمُ إلى حقيقة.
امسك حبلًا في يديك والْوِه. إذا لففتَه في نفس الاتجاه الذي لُفَّتْ به خيوطُ الحبل الفردية بعضها حول بعض، فستصل إلى مرحلةٍ لا يكون فيها الحبل قابلًا للَّفِّ أكثر من ذلك، وسيحاول أن يتجعَّدَ في أشكال ذات التواءات أكبر. وإذا لففتَه في الاتجاه المعاكس، فستنفصل أليافُ الحبل بعضها عن بعض في مكانٍ واحد على الأقل، لتكوِّن أنشوطة.
تخيَّلِ الآن أن معك ملقاطًا متناهي الصِّغَر يُمكِّنك من عمل نفس نوع الالتواء والدوران الذي قمتَ به مع الحبل، ولكن هذه المرة مع الحمض النووي المزدوج الجديلة. وحسبما أعلن فينسنت كروكيت في اجتماع ورشة عمل عُقِد عام ???? لمؤسسة نانونيت التي يموِّلها المجلسُ البحثي للعلوم الفيزيائية والهندسية، فإن فريقه من معمل الفيزياء الإحصائية التابع للمركز القومي للأبحاث العلمية في باريس قد توصَّلَ في واقع الأمر إلى طريقةٍ معروفةٍ باسم «المِلقاط المغناطيسي» أتاحت لهم تحقيق هذا. وبصفة عامة، يلصق الباحثون أحدَ طرفَي اللولب المزدوج للحمض النووي بدعامة صلبة، والطرف الآخَر بكُريَّة مغناطيسية يمكنهم تحريكها وقلْبها في مجالٍ مغناطيسي غير متجانس.
يُعتبَر الشكل الذي تدور به الكُريَّة لتلتوي وتفك الحبل الجزيئي مثالًا آخَر للأشياء المذهلة التي يمكن للمرء أن يفعلها على المستوى النانوي هذه الأيام. ولكن هذه الحالة تتميَّز بميزة إضافية نظرًا لكونها مفيدةً بعدة طرق، حسبما يتضح من اهتمام علماء البيولوجيا الجزيئية، المتحمسين لاستخدام المِلقاط المغناطيسي لحلِّ المشكلات التي يواجهونها في تضاعُف الحمض النووي واستنساخه. وعمومًا، فإن جميع العمليات الطبيعية التي تنطوي على تعديل الحمض النووي أو قراءته تتطلَّب قدرًا من الالتواء. وعندما يراقب الباحثون كلًّا من الدوران والقوى المستخدَمة، فإنهم يستطيعون أن يتوصَّلوا إلى معلومات غير مسبوقة حول هذه التفاعلات. يقول كروكيت: «النتيجةُ الأكثر روعة أنك ترى إنزيمًا في أثناء عمله فعليًّا.»
لقد تعاوَنَ كروكيت بالفعل مع فريق زميله جي شارفين من المركز القومي الفرنسي للأبحاث العلمية للعمل على إنزيمات توبوأيزوميريز الحمض النووي (وهي إنزيمات تفكُّ التفافَ الحمض النووي بعمل قَطْعٍ مؤقَّتٍ في إحدى الجديلتين، يمكن للجديلة الثانية المرور من خلاله) وبالتعاون مع فريقٍ بقيادة جوزيبي ليا من جامعة ميلان عمل على البروتين الكابح «جال» Gal الذي يمنع الاستنساخ عن طريق ربط الحمض النووي في أنشوطة. وأثبتَتِ الدراساتُ التي أُجرِيت على الجزيئات الأحادية حدوثَ انحلالٍ بسيط في اللولب المزدوج يصبُّ في صالح ارتباط بروتين شبيه بالهيستون معروف باسم «إتش يو» HU، يعمل عندئذٍ على ربط الجزء الضعيف من الحلزون بحيث يتمكَّن جزيئَا البروتين الكابح من إغلاقِ الدائرة. في ورشة العمل، قدَّمَ كروكيت أبحاثًا جديدة عن الحلزونين «يو في آر-دي» Uvr-D و«آر إي سي-كيو» Rec-Q. يستطيع هذان الإنزيمان الاتحاد بطرف مفكوك بارز من اللولب المزدوج وفك البنية من هذا المكان. وفي العادة، يظلان ملتصقين بجديلة حمض نووي محدَّدة، ويتحركان من الطرف ? إلى الطرف ?؛ أيْ عكس اتجاه القراءة الطبيعي. ومع أن مثل هذه الإنزيمات ضروريةٌ لعدة أنواع مختلفة من إصلاح الحمض النووي، ومن أجل تضاعُف عددٍ من البلازميدات؛ فإنه لم يُعرَف الكثيرُ عن وظيفتها بتفاصيل جزيئية. وفي بحث لاحق، وصف كروكيت وزملاؤه بالتفصيل السلوكَ الميكانيكي لهيليكاز «يو في آر دي» UvrD. وفي نفس ورشة العمل، قدَّمَ رالف زايدل من الجامعة التكنولوجية في مدينة دلفت (هولندا) مشروعًا آخَر باستخدام المِلقاط المغناطيسي، وهو مشروع مشترك بين معامل كيس ديكر في مدينة دلفت (المشهورة بأبحاثها عن الأنابيب النانوية الكربونية)، وكيث فيرمان من جامعة بورتسموث في إنجلترا الذي ينظِّم ورش عمل نانونيت. يدرس هؤلاء الباحثون النمطَ ? من الإنزيم القاطع الداخلي، وهو نوع من إنزيمات تعديل الحمض النووي التي تتميَّز بوجود مسافة طويلة بين تسلسلات الحمض النووي التي تتعرَّف عليها وتلك التي تستطيع فعلًا قطْعَها.
بين هذين الحدثين، لا بد أن ينتقل الإنزيم مسافةً تصل إلى بضعة آلاف من الأزواج القاعدية بطول اللولب المزدوج، مُتبِعًا الالتواء الحلزوني. لكن على العكس، هذا يعني أن إنزيمًا ثابتًا بهذا النوع يستطيع تحريك جديلة الحمض النووي المزدوجة بنفس الطول، في نفس الوقت الذي يلفها فيه. وباستخدام أسلوب الكُريَّة المغناطيسية، يستطيع الباحثون الآن تسجيلَ هذه الحركة، وكذلك تطبيق قوة مضادة لقياس مدى قوة الإنزيم الداخلي وفاعليته باعتباره محركًا جزيئيًّا، وقد قاسوا سرعةَ التحرُّك لأكثر من ??? زوج قاعدي في الثانية.
ولكن بخلاف فائدة قياس البيانات الفيزيائية على المستوى الجزيئي، فثمة احتمالية أيضًا لظهور تطبيقاتٍ عملية. يصف كيس ديكر هذا الأمر بقوله إنه «الخطوة الأولى نحو تصميم محرِّك بيولوجي. ويستطيع هذا الجهاز أن يربط بين العالَمَيْن البيولوجي والسليكوني.»
بالنسبة إلى أيِّ شخص يفكِّر في استخدام هذه التقنية في التعامل مع الجزيئات، فإنني أودُّ أن أبشِّرَه بأن مستقبلها واعد. يقول كروكيت: «نتعاون حاليًّا لابتكار جهاز مِلقاط مغناطيسي قابل للاستخدام التجاري.» ومع أن أسلوب القياس يتطلَّب عادةً مساعدةَ عالِم فيزياء في البداية، فإنه يَعِدُ بأنها سرعان ما ستصبح إجراءً روتينيًّا سهلًا، كما أن «المهارة البيولوجية هي أهم جانب»؛ وهو ما يعني أنك إذا استطعْتَ أن تحرِّك الجزيء الذي تدرسه وتلصِق كُريَّةً بالطرف الآخَر، فستكون قادرًا أيضًا على أن تلويه.
(????)
أحدث التطورات

لم تبلغ مسامعي أي أخبار مؤخرًا عن هذا المجال، ولكننا بانتظار معلومات قريبًا.
قراءات إضافية

G. Charvin et al., Proc. Natl Acad. Sci. USA, 2003, 100, 9820.
G. Lia et al., Proc. Natl Acad. Sci. USA, 2003, 100, 11373.
Nanonet UK: www.nanonet.org.uk.

الفصل الرابع عشر
الحمض النووي المتعدِّد الأغراض


إنَّ «سوءَ استغلال الحمض النووي» من الموضوعات التي تناولتُها مرارًا وتكرارًا منذ البداية، وأعتقد أن مكعب الحمض النووي الذي ابتدعه نيد سيمان كان يمثِّله. في البداية، بَدَا الأمر من باب التسلية (انظر مقال «ألعاب الحمض النووي» لتحظَى بأفكار عن هذه المرحلة «الغريبة» في هذا المجال)، ولكن سرعان ما ظهرَتْ من هذه التسلية أمورٌ ذات إمكانات واقعية للغاية، مثلما توضِّح هذه الأمثلة.
كمبيوتر الحمض النووي يدخل المجال الطبي

في عام ????، فاجَأَ اختصاصي علوم الكمبيوتر ليونارد أدلمان العالَمَ بعرضِ أولِ حوسبةٍ معتمِدة على الحمض النووي. ومع أن عمليته الحسابية الأولى كانت مجردَ دليلٍ على صحة المبدأ، أو مجرد مهمة بسيطة تُؤدَّى بقدر مفرط من العمل المكتبي، فسرعان ما اتضح أن أجهزة كمبيوتر الحمض النووي قد تصبح ذات يومٍ مفيدةً حقًّا إذا أمكن تشغيلها أوتوماتيكيًّا بالكامل وتصغيرها على مستوى الخلية. بعد ذلك بعشر سنوات، صمَّمَ فريقٌ بقيادة إيهود شابيرو من معهد فايتسمان جهازًا آليًّا بالحمض النووي يستطيع «تشخيصَ» أعراض السرطان ووصف «العلاج»، «في المعمل» على الأقل.
في بعض حالات السرطان، بما فيها سرطان البروستاتا الشهير، يعتمد التشخيص الروتيني بالفعل على البصمة الجزيئية بدلًا من الانحرافات التشريحية. وباستخدام مستويات التعبير الجيني التي يستخدمها الأطباء عادةً للتعرُّف على هذا السرطان، صمَّمَ فريق شابيرو جزيءَ حمض نووي حاسوبيًّا يستطيع التعامل مع سلسلةٍ من خمسة أسئلة بنعم أو لا بهدف تحديد إنْ كانت الواسِمات النمطية لسرطان البروستاتا موجودةً أم لا. وعمومًا، يحتاج الكمبيوتر الجزيئي إلى خمس إجابات بالإيجاب (أيْ يحتاج إلى وجود خمسة واسِمات) لكي يستطيع ضخَّ الدواء.
الكمبيوتر الجزيئي عبارة عن انعطاف طويل من الحمض النووي يشبه دبوسَ الشعر (أيْ أنه لولب مزدوج يتكوَّن من جزيء أحادي مطوي على نفسه) يحتوي على جزيء الدواء (جديلة قصيرة من الحمض النووي تتداخل مع تنظيم الجين) في طيته. ويحتوي الجذر المزدوج الجديلة للدبوس على خمسة «أقفال»، كلٌّ منها يمكن فتحه وإزالته بواسطة «مفاتيح» معيَّنة؛ أيْ في وجود الحمض الريبي الرسول التشخيصي في الكميات التي تتخطى قدرًا معينًا. وعندما تُفتَح جميع الأقفال الخمسة، يُضَخُّ الدواء.
نجح الباحثون في استخدام هذا الجهاز الآلي مع نظامٍ اختباريٍّ يعيد إنتاجَ البصمات الجزيئية العادية لسرطان البروستاتا «معمليًّا»، ثم شرعوا في استخدام «علاج» مماثِل على نموذج أنبوبة اختبار يحتوي على خلايا صغيرة من سرطان الرئة. ومع هذا، التزَمَ شابيرو الحذرَ في مقابلاته الصحفية، وقال: «قد يستغرق الأمر عقودًا من الزمان قبل أن يتحوَّل مثل هذا النظام الذي يعمل داخل جسم الإنسان إلى واقع.» وبصرف النظر عن المخاوف بشأن قدرة الكمبيوتر الجزيئي على البقاء داخل الجسم، فإن عملية إدخال المادة الوراثية في شخصٍ (يُفترَض أنه موفور الصحة) تستوجب النظرَ إليها باهتمام بالغ؛ فعلى عكس أنبوب الاختبار المحتوي على نماذج السرطان، قد يحتوي الجسم على عوامل بروتينية أو جزيئات حمض ريبي رسول معدَّلة تتَّحِدُ مع كمبيوتر الحمض النووي بطرقٍ لا يمكن توقُّعها بسهولةٍ، حتى لو تعرَّض التسلسل الجينومي بأكمله للفحص سلفًا.
مع هذا، أعادَتْ هذه التجارب التطبيقات الصناعية المعتمِدة على الحمض النووي، التي ظلَّتْ عشر سنوات في الملعب الجزيئي؛ إلى العالم الواقعي وإلى احتمالية الاستفادة الحقيقية منها. وفي تطوُّر مماثِل في مجال البنى الصناعية الثلاثية الأبعاد المعتمِدة على الحمض النووي، قدَّمَ جيرالد جويس جدائلَ حمض نووي قابلة للاستنساخ يمكن طيها لتكوِّن مجسمات ثمانية من تلقاء نفسها. ويبشِّر الدمج بين القوى البنيوية والحوسبية للحمض النووي بكفاءتها الطبيعية للعمل على مستوى الجزيء الواحد ومضاعفته؛ بعهدٍ جديد لتكنولوجيا النانو والطب.
شكل ??-?: طبيب الحمض النووي. موضَّحٌ هنا نسخة مبسَّطة تحتوي على قفلين فقط يلزم فتحهما حتى يمكن ضخُّ دواء الحمض النووي (الطيَّة الدبوسية). ويتحد مفتاحٌ معيَّن لكلِّ قفل مع التسلسل القصير للحمض النووي الأحادي الجديلة في نهاية الأمر، وبإكمال اللولب المزدوج، يكمل المفتاح أيضًا موقع قَطْع خاص بإنزيم قَطْع معيَّن يقص اللولب المزدوج بطريقة محدَّدة؛ مما يفتح الطريقَ أمام القفل الثاني.
حمضٌ نووي بيدين وقدمين

في الماضي كان الحمض النووي خبيرَ المعلومات الذي ترك ساحة العمل للبروتينات، أو ربما بعض جزيئات الحمض النووي الريبي. ولكن الأمر لم يَعُدْ كذلك؛ فبفضل بعض تسلسلات الحمض النووي المصمَّمة بذكاء، تستطيع المادةُ الوراثية الآن تكوينَ بنًى معقَّدةٍ وأسلاكٍ كهربائية وأجهزةِ كمبيوتر جزيئية، بل تستطيع الآن أيضًا تكوينَ آلات ذات أجزاء متحركة. وعقب ابتكار جهاز طبي أوتوماتيكي معتمِد على الحمض النووي (المذكور أعلاه)، أظهَرَ بحثان أن الحمض النووي يمكن أن تكون له يدان للإمساك بالأشياء وإفلاتها، وقدمان من أجل جولات المشي الجزيئية.
صمَّم فريق بقيادة فريدريك سيميل من جامعة ميونيخ بألمانيا «يدَ» حمض نووي يمكن توجيهها للإمساك بجزيء إنزيم ثرومبين وإفلاته على نحوٍ دوريٍّ ومتكرِّر. ويعتمد الجهاز على تسلسُلِ حمض نووي مكوَّن من ?? قاعدة، أو ما يُسمَّى بالأبتامير، المعروف عنه أنه يتَّحد بالثرومبين. ويقول سيميل: «لقد اخترنا أبتامير الثرومبين لأنه كان قصيرًا، وواضحَ المعالِم، ويتمتع بثابت انفصال منخفض.» وقد دمج سيميل هذا العنصرَ بذيل مكوَّن من ?? قاعدة يتيح التحكُّمَ في اليد بواسطة تسلسلات حمض نووي إضافية. وعن طريق إضافة جزيء حمض نووي معين Q يتعرَّف على هذا الذيل، استطاع الباحثون طردَ الإنزيم المرتبط. ويتفوق تسلسل حمض نووي آخَر R في المنافسة أمام «اليد» خلال تفاعُله مع جزيء Q، وبالتالي يحرِّره ليتَّحِدَ مع الإنزيم مجدَّدًا. في الوقت نفسه، صمَّمَ ويليام شيرمان ونيد سيمان (المشهور بتصميمه أجسامًا ثلاثية الأبعاد من الحمض النووي) من جامعة نيويورك إنسانًا آليًّا من الحمض النووي بإمكانه السير، وذلك باستخدام أسلوب مماثِل؛ تتكوَّن قدماه من تسلسلات مختلفة، تتعرَّف تحديدًا على نوعين من موطئ القدم على مسار الحمض النووي الذي يسير عليه. أما عن جدائل الحمض النووي القابلة للذوبان والمضافة للتفوُّق على تفاعلات الارتباط، فإنها تتيح للباحثين الحصولَ على إنسان آلي من الحمض النووي يسير بطريقة موجَّهة ومحكومة.
يدرك سيميل أن «اليد» التي ابتكرها و«القدم» التي ابتكرها سيمان تلتقيان على نحوٍ طبيعي، فيشرح قائلًا: «بالاشتراك مع الأحماض النووية السائرة، فإن جهازنا يستطيع تشكيلَ الجزء الناقل في محرِّك الحمض النووي الذي يمسك بالجزيء في مكانٍ ويحرِّره في مكان آخَر. ويمكن تصميم أجهزة مماثلة تتَّحِد مع جزيئات غير بيولوجية بدلًا من البروتينات، أو تطلقها.» ويُثبِت بحث آخَر من معمل سيميل أن ماكينات الحمض النووي يمكن التحكُّم فيها بيولوجيًّا، عن طريق عملية استنساخ الخلية. ومن الواضح أنه مع تطوُّر روبوتات الحمض النووي بهذه السرعة، فلن يمر وقت طويل حتى تبدأ في التحدُّث وتقديم المشروبات.
(????)
أحدث التطورات

في عام ????، أعلن باحثون يعملون على مشروع أوريجامي الحمض النووي في معهد كاليفورنيا للتكنولوجيا؛ عن صور ثنائية الأبعاد تمَّ إنتاجها عن طريق تصميم تسلسلات الحمض النووي، وقد تصدَّرَتِ الوجوهُ الضاحِكةُ المصنوعة من الحمض النووي غلاف مجلة «نيتشر» بتاريخ ?? مارس ????.
قراءات إضافية

Y. Benenson et al., Nature, 2004, 429, 423.
W. M. Shih et al., Nature, 2004, 427, 618.
W. U. Dittmer et al., Angew. Chem. Int. Ed. 2004, 43, 3550.
W. B. Sherman and N. Seeman, Nano Lett., 2004, 4, 1203.
W. U. Dittmer and F. C. Simmel, Nano Lett., 2004, 4, 689.

الفصل الخامس عشر
الانبهار بالدياتومات


خلال السنوات التي قضيتُها كباحث في مرحلتَي الدراسات العليا وما بعد الدكتوراه، مرَّ بي العديد من الطلاب الجامعيين، ومعظمهم لم أرَه مجدَّدًا، ولكن كان هناك طالب ظلَّ يفاجئني بنشر مقالات بحثية شديدة الروعة. في عامي الأول للتحضير للدكتوراه في جامعة ريجنسبورج بألمانيا، انضمَّ نيلز كروجر إلى فريق جينيكا من أجل دورةٍ عمليةٍ قصيرة، ثم فاجَأَ الجميع باختياره معملًا مختلفًا من أجل الدبلومة ورسالة الدكتوراه التي يعمل عليهما، ولكنه حقَّقَ نجاحًا باهرًا؛ إذ تخصَّص عمليًّا في مجال التحليل الكيميائي الحيوي لأصداف الدياتومات. ومع أنني كنتُ مستعدًّا لعرض أبحاثه حتى لو كان الذي كتبها شخصًا غير مشهور بعدُ، فقد كنتُ سعيدًا بالكتابة عن هذه الأبحاث وأنا أعلم أن هذا العملَ الفذَّ توصَّل إليه شخصٌ كنتُ أعرفه قبل أن يحصل على شهادته العليا.
ابنِ صَدفة الدياتوم الخاصة بك

الدياتومات هي طحالب وحيدة الخلية تمثِّلها آلاف الأنواع في المحيطات وبحيرات المياه العذبة حول العالم، وهي تكوِّن الأصدافَ بأنماط جميلة ذات مسام تحت مجهرية؛ مما مثَّلَ تحدِّيًا رئيسيًّا في أبحاث التشبُّع البيولوجي بالمواد المعدنية. وبما أن هذه الأنماط محدَّدة وراثيًّا، فبالتأكيد ثمة جزيئات حيوية مشتركة في الأمر، ولكنها مختلفة كليةً عن البروتينات العادية التي استغرق الباحثون سنواتٍ عديدة لمجرد استخراجها من مادة الصَّدفة.
سبق أن قام نيلز كروجر وزملاؤه من جامعة ريجنسبورج بألمانيا بعزل العديد من الببتيدات المختلفة (تُسمَّى السيلافينات) ومركبات عديدة الأمين طويلة السلسلة من أصداف الدياتومات، وأثبتوا أنها تحفِّز ترسيبَ السليكا. وفي عام ????، أعلن الفريق أن تعديلات ما بعد التخليق، بما في ذلك امتدادات عديد الأمين المتصلة ببقايا الليسين وأحماض السيرين المفسفرة؛ ضرورية لوظيفة السيلافينات داخل الجسم الحي. وعندما استخلص الباحثون لأول مرة السيلافينات من الدياتومات باستخدام فلوريد الهيدروجين، فُقِدت هذه التعديلات، والآن استعادوا النُّسَخ «الطبيعية» الكاملة من جميع السيلافينات الثلاثة التي عثروا عليها في «سيليندروثيكا فوسفورميس»، ووضعوا طريقةً للتنبُّؤ بكيفية دمج هذه الجزيئات بهدف الحصول على بنًى نانوية شبيهة بالدياتوم في أنبوب الاختبار.
شكل ??-?: صورة مجهرية إلكترونية لأصداف الدياتومات. الأنماط المعقَّدة الشبيهة بالأسواط ذات المسام النانوية الحجم تكون محدَّدة وراثيًّا. أما السؤال عن منشأ هذه الأنماط فسيظلُّ أحدَ أصعب الأسئلة التي يواجهها علمُ الأحياء الحديث.
اكتشف كروجر وزملاؤه أن السيلافين الطبيعي من النمط ? — الذي هو عبارة عن بروتين فسفوري مكوَّن من ?? كيلو دالتون — ليس له في حدِّ ذاته إلا تأثير محدود على تكوين ترسبات السليكا. ولكن في وجود السيلافين الطبيعي من النمط «? إيه» 1A (المكوَّن من ??? كيلو دالتون) تصبح له وظيفة تنظيمية؛ إذ إنه يستطيع أن يحفِّز نشاطَ البروتين الآخَر أو يثبطه، بحسب التركيزات النسبية. ولا بد أن يحتوي الحدُّ الأدنى من مجموعة أدوات البناء، اللازمة لبناء بنى سليكا تتمتَّع بمسام ذات حجم مناسب (???–???? نانومتر) «في المعمل»؛ على مكوِّن كاتيوني واحد مثل عديد الأمين الطويل السلسلة أو السيلافين الطبيعي من النمط «? إيه» بتعديلاته في عديد الأمين، بالإضافة إلى مكون أنيوني واحد مثل السيلافين الطبيعي العالي الفسفرة من النمط ?. ويقترح الباحثون أن هذين المكونين الضروريين يكوِّنان شبكة ذاتية التجميع بناءً على التفاعلات الكهروستاتيكية. وفي جميع التكوينات التي تمَّتْ دراستها، يحفِّز الجزيء الكاتيوني تكوينَ السليكا، في حين ينظِّم الجزيء الأنيوني العمليةَ. إذا أصبحَتْ هذه الطريقةُ صالحةً للتطبيق على نطاق كبير، فستتيح للباحثين تجربةَ عددٍ لا نهائي من الصور الجزيئية في هذا الشأن، وبالتالي تمهِّد الطريقَ أمام المواد المخلَّقة النانوية البنية اعتمادًا على مبادئ بنية الدياتوم.
(????)
علماء تكنولوجيا النانو يستعينون بمهندسي الطحالب

تتسم الدياتومات بمهارة معمارية منقطعة النظير على المستوى النانوي؛ فالأصداف السليكونية لهذه الطحالب الوحيدة الخلية عبارة عن صناديق مسامية شديدة التناسق ذات أنماط شبيهة بالأسواط ومحدَّدة وراثيًّا بأبعاد نانوية. وسيكون التحكم على نحوٍ مماثِلٍ في العمليات النانوية البنية مفيدًا في العديد من مجالات تكنولوجيا النانو، إلا أن محاكاة بنية الدياتوم تُعَدُّ تحدِّيًا رئيسيًّا في هذا الشأن. فالآن، اكتشَفَ باحثون من الولايات المتحدة أن صَدفة الدياتوم الطبيعية يمكن استخدامها كأساس لِلْبِنى النانوية الصناعية، وهو سبيل أسهل بكثير من المحاكاة البيولوجية.
قام تشاد ميركين وزملاؤه من جامعة نورثويسترن في إيفانستون بولاية إلينوي بتجريد الدياتومات وصولًا إلى هيكلها اللاعضوي المجرَّد؛ وذلك عن طريق تغطيسها في حمام حمضي يُطلَق عليه «البيرانا». أتاحت هذه المعالجة استغلال الأصداف من قِبَل كاشف الحمض الأميني، كما استُخدِمت الوظائفُ الأمينية الحرَّة بدورها لدمج الحمض النووي القليل النيوكليوتيدات بأصداف الدياتوم. واستخدم الباحثون جدائل الحمض النووي التكميلي المرتبطة بجسيمات الذهب (?? نانومترًا) لجعل الطبقة الخارجية مرئيةً بسهولة تحت الميكروسكوب الإلكتروني، فأثبتوا أن سطح الصَّدفة الخاوية بأكمله يمكن توظيفه في المواد الصناعية وتغطيته بها. علاوة على ذلك، يمكن أن يضيف الباحثون ست طبقات ذهبٍ إضافية إلى الطبقة الأولى.
سار الإجراء على ما يرام في نوعي دياتوم مختلفَين، وهما: «سيندرا» و«نافيكولا»، وبالتالي قد يختار الباحثون ذات يومٍ أيًّا من آلاف السلالات المختلفة للدياتومات لأغراضهم الخاصة. على سبيل المثال، لتصميم نمط معيَّن نانوي الحجم بجسيمات الذهب (أو غيرها)، سيكون على المرء أن يجد فقط صَدفةَ دياتوم مقابلة والعمل بناءً عليها، أو بدلًا من ذلك يمكن للمرء «بسهولةٍ تعديلُ أسطح الدياتوم بالعديد من المجموعات الوظيفية المختلفة» حسبما يقترح ميركين. وعلى سبيل المثال، قد يُنتِج المرءُ مصفوفاتِ حمضٍ نووي متناهية الصِّغَر بأعداد هائلة من النُّسَخ.
(????)
أحدث التطورات

لقد ظلَّ فهم بنية صَدفة الدياتوم ومحاكاتها أحدَ أكبر التحديات وأكثرها إثارةً على صعيد التداخُل بين علم الأحياء وتكنولوجيا النانو. ففي مارس ????، أعلن فريق كروجر ثبات أحد البروتينات على صَدفة السليكا الخاصة بالدياتوم. وفي وقت لاحق من نفس العام، وصف فريق بورنر من معهد ماكس بلانك للمواد الغروانية والأسطح البينية في مدينة جولم بألمانيا خيطًا من الزجاج الحيوي مصمَّمًا من ببتيدات وسليكا الدياتوم.
قراءات إضافية

N. Kr?ger et al., Science, 2002, 298, 584.
N. Poulsen et al., Proc. Natl Acad. Sci. USA, 2003, 100, 12075.
N. L. Rosi et al., Angew. Chem. Int. Ed., 2004, 43, 5500.

الفصل السادس عشر
إشاراتٌ تحذيرية من الطبيعة


أحيانًا يمكن لتجربة غاية في البساطة يستطيع أيُّ طالب في المرحلة الابتدائية تصميمها، بل في الواقع يستطيع حتى إجراءها أيضًا؛ أن تقدِّمَ معلومةً مهمة عن الكيفية التي يعمل بها عالمنا. وإحدى هذه التجارب الشديدة البساطة والذكاء في الوقت نفسه معروضة في المقال الرائع التالي.
في المعمل، يجب أن تحمل جميعُ الزجاجات التي تحتوي على موادَّ سامة ملصقًا تحذيريًّا معروفًا على مستوى العالم. وفي الطبيعة، ثمة أنواع مختلفة تنتج موادَّ سامة لتجعل نفسها غير مستساغة للكائنات المفترسة، وقد اتضح أنها غالبًا تشترك في علامات تحذيرية عالمية، مثل الأنماط الظاهرة زاهية الألوان. ومع أن هذا التوحيد داخل المعمل يرجع إلى التشريعات القانونية ويحافظ على سلامة الشخص الذي قد يبتلع السمَّ، فإن الظاهرة الطبيعية المعروفة باسم المحاكاة المولرية تنشأ عن ميزة تطوُّرية لا تمنحها للآكِل (المفترس) الذي يتم تحذيره، وإنما تمنحها للوجبة (الفريسة) التي تنجو. وإذا تشاركَتْ عدةُ أنواع تكلفةَ الأخطاء التي يرتكبها المفترسون في أثناء تعلُّم قراءة الإشارات التحذيرية، فستكون الخسارة التي يتكبَّدُها كلٌّ منها أقل. ومن خلال تجربة رائعة وبسيطة للغاية، اكتشف الباحثون البريطانيون ميزةً إضافية للأنواع المتشاركة.
قام جون سكيلهورن وكاندي رو من جامعة نيوكاسل بإطعام الدجاج فتات خبز أحمر مُعالَجًا بمادة الكينين أو البتريكس (المادة التي تمنع قضم الأظافر)، أو بمزيجٍ من الاثنتين، إلى جانب فتات خبز أخضر تمَّ رشُّه بالماء فقط. وخلال ست تجارب، تعلَّمَ الدجاج الذي ابتلَعَ مادة واحدة فقط من المادتين الكيميائيتين المُرتين أن يتجنَّبَ الفتاتَ الأحمر. والمثير للدهشة أن الدجاج الذي تعرَّضَ لخليطٍ من الفتات بطعم البتريكس والكينين تعلَّمَ الدرسَ في نصف الوقت. وعلاوة على ذلك، في اختبار استمر لمدة أربعة أيام بعد التدريب، فإن الدجاج الذي تعرَّض لمادتين مختلفتين مُرَّتين، كان أفضل في تجنُّب الفتات الأحمر من كلتا المجموعتين اللتين تعرَّضَتَا لإحدى المادتين المُرتين فقط.
تشير هذه النتائج إلى أنه — علاوةً على ميزة «التكلفة المشتركة» — فإن مشاركة الإشارات التحذيرية بين أنواع الفرائس ذات المواد السامة المختلفة توفِّر حمايةً إضافية؛ لأنها تجعل الإشارة التحذيرية أسهل في تذكُّرها. وهذه من مقومات السلامة المعملية الضرورية التي وفَّرَتْها الطبيعة قبل أن توفِّرها جميع تلك الملصقات الصفراء والسوداء بوقت طويل!
(????)
قراءات إضافية

J. Skelhorn and C. Rowe, Proc. Roy. Soc. Lond. B, 2005, 272, 339.

الفصل السابع عشر
كل المصاوغات المِرآتية على شريحة واحدة


تجربةٌ أخرى بسيطة ولكنها فعَّالة، مع أنها تتخطى هذه المرة مستوى المدرسة إلى حدٍّ ما.
إنَّ إنتاج نسخة واحدة فقط من جزيئين متطابقين كالمرآة هو أحد أهم التحديات التي يواجهها علماء الكيمياء اليوم. ويُعتبَر التحفيز العديم التناظر المِرآتي — الذي يتم فيه تسريعُ مسار التفاعل بما يؤدِّي إلى إنتاج النسخة المطلوبة (المصاوغ المِرآتي) وليس النسخة التي تنتج صورتها المِرآتية — وسيلةً واعِدة للحصول على المصاوغات المِرآتية الصِّرفة اللازمة في العديد من التطبيقات، خصوصًا في صناعة العقاقير. في عام ????، نجح علماء الكيمياء بألمانيا في الدمج بين التحفيز العديم التناظر المِرآتي والفصل التحليلي للمصاوغات المِرآتية الناتجة على شريحة واحدة. ويصلح منهجهم في الفحص العالي الوتيرة بحثًا عن مواد محفِّزة انتقائية للمصاوغات المِرآتية.
صمَّمَ فريقان بقيادة ديتليف بيلدر ومانفريد ريتز من معهد ماكس بلانك في مولهايم بألمانيا، شريحةَ تحفيز/تحليل متكاملة تربط قناة التفاعل بقناة الفَصْل. تُعبَّأ المواد الكاشفة في قوارير مجهرية منفصلة، حيث تُمتَصُّ في قناة التفاعل المتعرجة الطويلة، المصمَّمة لضمان امتزاجِ تلك المواد وتحضينها، باستخدام الفراغ أو المجال الكهربائي. وتعمل نسخة مصغَّرة من الترحيل الكهربائي الشعيري، معروفة باسم الترحيل الكهربائي ذي الشريحة المجهرية، على فصل نواتج التفاعل وتحليلها. وقد أثبَتَ بيلدر وزملاؤه سابقًا أن هذه التقنية يمكنها فصل المصاوغات المِرآتية بسرعة فائقة.
وبصفتها تطبيقًا أوليًّا لنظام المعمل المجهري الجديد الذي توصَّلَ إليه الباحثون، فقد حلَّلوا انتقائية المصاوغات المِرآتية الامتثالية لإنزيمات هيدروليز الإيبوكسيد الطافرة، وهو ما يرتبط ببحث ريتز عن تفعيل الإنزيمات بواسطة التطور الصناعي. وفي حالة إنزيم النمط البري المأخوذ من فطر الرشاشية السوداء «أسبرجلس نيجر»، استطاع الباحثون استخدامَ حُلالات خلوية وخلايا كاملة من أجل التحليل. وبالإضافة إلى هذا التطبيق، يقول الباحثون: «يتمتع الجهاز أيضًا بإمكانات محتمَلة رائعة في مجال الفحص العالي الوتيرة.»
يوافقه هذا الرأي هانز نيمانتسفردريت من جامعة آيندهوفن للتكنولوجيا في هولندا قائلًا: «يوضِّح البحثُ بأسلوب رائع إمكاناتِ الأجهزة التحفيزية المصغَّرة للأغراض البحثية. وأنا مقتنع بأن للأجهزة التحفيزية التي يتراوح حجمها ما بين الصغير والمتوسط مستقبَلًا أيضًا في مجال إنتاج المنتجات المتخصصة، خصوصًا لو عرفنا كيفية دَمْجِ المواد المحفِّزة الذكية مع تقنيتَي القياس والتحكُّم على المستوى المجهري.»
(????)
أحدث التطورات

جمع بحث لاحق قام به فريق بيلدر ونُشِر عام ???? بين مِطياف الكتلة بالسبراي النانوي وبين التفاعل ذي المائعية النانوية وأجهزة الفَصْل كما سأعرض لاحقًا. وبالتالي، فباستخدام شريحة واحدة تُوضَع في مِطياف الكتلة، يستطيع الباحثون إنتاجَ الجزيئات وتنقيتها وتحديدها بناءً على كتلتها الجزيئية.
قراءات إضافية

D. Belder et al., Angew. Chem. Int. Ed., 2006, 45, 2463.

الفصل الثامن عشر
قصتان عن البلاتينيوم


لا أعرف سبب اعتباري البلاتينيوم Pt عنصرًا مشوقًا. ربما يرجع هذا إلى حقيقة أنه عنصر نبيل للغاية، وبالتالي خامل، أما بصفته مادة محفِّزة شديدة الفاعلية فإنه يستطيع أن يلعب دورًا في الكثير من التفاعلات. وأذكر أنني حين استخدمْتُ إلكترود البلاتينيوم خلال البرنامج العملي لطلبة الجامعة، وَزَن المدرسون المساعدون العنصرَ قبل استعارتي إياه وبعدها بدقةٍ متناهيةٍ؛ لهذا أعتقِد أنه مادة ثمينة فعلًا. ولهذه الأسباب، أتابِع مجلة «بلاتينيوم ميتلز ريفيو» حيث أجد أحيانًا أروع المقالات، بما في ذلك المقالان التاليان. صور قيِّمة بالبلاتينيوم

صورة لطلوع القمر فوق البحيرة، طُبِعت بالبلاتينيوم ثم عُدِّلت بواسطة عملية ثنائي كرومات الصمغ، وبيعت بثلاثة ملايين دولار تقريبًا في دار سوذبي للمزادات عام ????، لتسجِّل بذلك سعرًا قياسيًّا جديدًا مقارَنةً بأية صورة فنية.
يرجع تاريخ تلك الصورة التي حطَّمت الأرقامَ القياسية في السعر، والتي كانت تحمل اسم «البِركة – ضوء القمر» إلى عام ????، وهي من عمل الفنان الأمريكي إدوارد ستايتكن (????–????). وعلى الرغم من وجود ثلاث صور من نفس الصورة السلبية (النيجاتيف)، فإن درجة المهارة اليدوية العالية المطلوبة لإنتاج كل صورة، إلى جانب العمر الطويل الذي يضمنه هذا المعدن النفيس؛ تساعِد في زيادة الطلب على مثل هذه الأعمال في عالم الفن.
يقول مايك وير، الخبير في تكنولوجيا التصوير الفوتوغرافي غير العادية: «انتشرت عملية الطباعة بالبلاتينيوم — التي اختُرِعت عام ???? على يد ويليام ويليس من مدينة بروملي في مقاطعة كينت — عام ???? تقريبًا، ويُنظَر إليها باعتبارها أرقى الوسائل لتصميم صورة فوتوغرافية باقية وجميلة. وكان ورق الطباعة بالبلاتينيوم متاحًا تجاريًّا، ولكنه أغلى بعض الشيء من ورق هاليد الفضة المستخدَم اليوم.»
في حالات نادرة، مثل حالة صور ستايتكن، تُستخدَم صور البلاتينيوم الأصلية باللونين الأبيض والأسود باعتبارها ركيزةً يُضاف إليها المزيدُ من الطبقات ذات الألوان والدرجات اللونية المختلفة.
وضع ستايتكن محلولًا من الصمغ العربي وصبغة وثنائي الكرومات على الصورة، ثم عرَّضَها للصورة السلبية (النيجاتيف) مرةً ثانيةً. يحفِّز الضوء اختزالَ ثنائي الكرومات إلى أكسيد الكروم الثلاثي، الذي يستطيع أن يربط جزيئات الصمغ الكبرى على نحوٍ متقاطع، ويجف الصمغ بعد ذلك على هذا النحو ويحبس الصبغة. وباستخدام هذه العملية، يمكن إضافة العديد من الطبقات التي تدمج صبغات مختلفة، لتتحوَّل الصورةُ الأصلية بالأبيض والأسود إلى عمل فني ملون، وقيِّم.
رُوبِلات البلاتينيوم

خلال فترة امتدَّتْ حوالي عقدين من الزمان في القرن الثامن عشر، كانت الرُّوبِلات المصنوعة من البلاتينيوم النقي (تقريبًا) هي العملة الرسمية في روسيا (وكانت أيضًا أولى العملات على الإطلاق التي تُصنَع من هذا المعدن)، وقد سُحبتْ عام ???? عندما أصبحت هدفًا جذَّابًا للمزوِّرين بسبب توافر البلاتينيوم الأرخص في كولومبيا. وقد استخدم الخبراء من شركتَيْ هيرايوس بألمانيا وجونسون ماتي بلندن جميعَ الطرق التحليلية غير الضارة المتاحة اليوم على مجموعة من العملات الباقية للتعرُّف على طريقةِ صنعها وكيفيةِ التمييز بين الحقيقية والمزيَّفة.
تملك شركة هيرايوس مجموعةً مكوَّنةً من أربع عملات (تبلغ قيمها الاسمية ?، و?، و?، و?? رُوبِلًا)، بالإضافة إلى ميدالية تُخلِّد ذكرى تتويج القيصر نيقولا الأول عام ????. أثبتت قياسات الكثافة لهذه العملات أن البلاتينيوم المستخدَم لسكِّها لم يكن نقيًّا. ومن بين المعادن الرئيسية المستخدَمة في تزييف تلك العملات؛ الذهب والإيريديوم والروديوم والحديد، وبناءً على نسبة الحديد إلى الإيريديوم، فإن هذه العملات غالبًا ما تكون عاليةَ النفاذية المغناطيسية. فحص الباحثون الألمان البِنى السطحية للعملات باستخدام كلٍّ من تقنيتَيِ الفحص بالميكروسكوب البصري والماسِح، وحلَّلوا المحتوى الداخلي بواسطة جهاز التداخل الكمي الفائق التوصيل، وبالاستعانة بهذه الطرق اكتشف الباحثون أن «إسفنجية» البلاتينيوم المفككة التي حصلوا عليها من مرحلة الإذابة لا بد أنها كانت مضغوطةً بفِعل الطَّرْق والبَسْط قبل سكِّ العملات.
تحتفظ شركة جونسون ماتي أيضًا بأربعة عملات من البلاتينيوم، يتحدد مَنشؤها من خلال النقوش المطبوعة عليها، ولكن على نحو غير حاسم. وقد كشفت الأبحاث التفصيلية عن طريق مقياسَي النفاذية المغناطيسية والكثافة، بالإضافة إلى الميكروسكوب الإلكتروني الماسِح وحيود الأشعة السينية؛ أن عملتين من هذه العملات تتمتع بدرجة نقاء أعلى على نحو ملحوظ من جميع الروبِلات الأصلية المعروفة، وبالتالي كانَتَا على الأرجح مزوَّرتين (على الرغم من أن المجرم الذي يضع مزيدًا من البلاتينيوم في عملة مزوَّرة أكثر مما تحتويه العملة الأصلية يكون غبيًّا على نحو استثنائي). إلا أن العملتين المتبقيتين — إحداهما بقيمة ? رُوبِلات ويعود تاريخها إلى عام ????، والأخرى بقيمة ? رُوبِلات ويعود تاريخها إلى عام ???? — تطابقان جميع الخواص المميزة الملحوظة في منتجات أخرى لمصنع البلاتينيوم التابع للقيصر، وبالتالي تُعتبَر أصليةً.
(????)
قراءات إضافية

M. Ware, Platinum Metals Rev. 2005, 49, 190.
M. Ware, Platinum Metals Rev. 2006, 50, 78.
C. J. Raub, Platinum Metals Rev. 2004, 48, 66.
D. F. Lupton, Platinum Metals Rev. 2004, 48, 72.
D. B. Willey and A. S. Pratt, Platinum Metals Rev. 2004, 48, 134.

الفصل التاسع عشر
إدخال الأسلاك النانوية إلى الخلايا العصبية


أعرف أنني كثير الحديث حول الإلكترونيات البيولوجية، وكيف أن الحدود بين النظامين الإلكتروني والبيولوجي آخذة في التلاشي تدريجيًّا، ولكن من بين جميع الأبحاث التي صادفتُها في هذا المجال، فإن هذا المثال تحديدًا أثارَ إعجابي أكثر من غيره؛ لأن في هذه الحالة — للمرة الأولى — كانت المكونات الإلكترونية تعمل على نفس مستوى الطول الخاص بالخلية العصبية التي تدخلها. هذا هو حقًّا طريق التقدُّم.
بدأ عصر الإلكترونيات البيولوجية الجديد — حيث تستطيع الأجهزة الإلكترونية أن تدخل بصورة مباشرة وسهلة إلى الكائنات الحية — بفضل أبحاث بيتر فرومهيرتس وآخَرين ممَّن نجحوا في توصيل أجهزة إلكترونية بخلايا عصبية معيَّنة. وقد ابتكر الآن فريق بقيادة تشارلز ليبر من جامعة هارفرد — الذي لعب دورًا رئيسيًّا في تطوير إلكترونيات الأسلاك النانوية على مدار السنوات الماضية — مصفوفاتٍ من ترانزستورات الأسلاك النانوية تستطيع الاتصال ليس فقط بخلايا عصبية معينة، ولكن أيضًا بشجيرات ومحاور عصبية بعينها (وهي تفرعات من الخلية العصبية) في مواضع متعددة.
شكل ??-?: محور خلية عصبية واحدة تمتد عبر مصفوفة مكوَّنة من ?? ترانزستورًا ذا أسلاك نانوية. رسمٌ تخطيطي معتمِد على الصور المجهرية للخلية العصبية والمصفوفة. يوجد جسم الخلية العصبية في القاع، ويمكن تتبُّعُ تقدُّمِ الإشارة العصبية بطول المحور في نفس وقت حدوثها باستخدام الترانزستورات.
صمَّمَ ليبر وزملاؤه مصفوفات من ترانزستورات الأسلاك النانوية المصنوعة من السليكون، وكبتوا فاعليةَ الوصلات لتجنُّبِ التآكل خلال فترات التحضين الممتدة اللازمة للمستنبت الخلوي (عشرة أيام عند درجة حرارة تبلغ ?? درجة مئوية). وبدلًا من الاعتماد على اللقاءات العشوائية بين الخلايا العصبية والأسلاك النانوية، صمَّموا أغشيةً متعدِّدةَ الليسين على الركيزة لتحديد المناطق التي أرادوا أن تنتشر فيها الخلايا العصبية. في التجارب النمطية، أضافوا الخلايا إلى الركيزة، وأمهلوها ساعةً لكي تلتصق، ثم أزالوا أية خلايا غير ملتصقة، ثم حضَّنوها لمدة تتراوح ما بين أربعة وثمانية أيام ليتيحوا للخلايا العصبية نشرَ محاورها وشجيراتها بطول المسارات المحددة سلفًا التي تؤدي إلى ترانزستورات الأسلاك النانوية.
بتطبيق هذا الأسلوب في العديد من البنى المختلفة، حصل باحثو هارفرد بانتظامٍ على نسبة عالية (أكثر من ???) من الوصلات النَّشِطة بين الأسلاك النانوية والشجيرات والمحاور العصبية. وفي إحدى التجارب، حُفِّزت خليةٌ عصبية واحدة لتمرر محاورها عبر مصفوفة مكوَّنة من ?? ترانزستورًا متراصًّا على امتداداتٍ تبلغ ?? ميكرومترات، ?? منها كوَّنَ وصلاتٍ وظيفيةً (انظر الشكل ??-?). وستتيح مثل هذه التكوينات للباحثين دراسةَ السلوك الكهربائي لخلايا عصبية فردية بتفاصيل غير مسبوقة وبأقل ضرر ممكن. حتى الآن، لا تزال هذه التجارب مجرد تجارب معملية، إلا أنه بالنظر إلى روعة هذه الطريقة ونسبة نجاحها وملاءمة حجمها، فمن المرجَّح أنه خلال بضع سنوات ستعمل الأسلاك النانوية على إعادة ربط المسارات العصبية المقطوعة لدى المرضى المصابين بالعمى أو الشلل الرباعي؛ وهو ما يعني أن الدمج بين علم الأحياء والإلكترونيات وشيكُ الحدوث.
(????)
قراءات إضافية

F. Patolsky et al., Science, 2006, 313, 1100.

الفصل العشرون
نحو مستشعر حيوي مثالي


كيفين بلاكسكو هو صديق قديم منذ بداية مرحلة ما بعد الدكتوراه في جامعة أكسفورد، وربما يكون واحدًا من العالِمين أو الثلاثة النابغين الذين أعرفهم من جيلي. وخلال عامَيْ ???? و????، ابتكر نوعًا رائعًا حقًّا من المستشعرات المعتمِدة على فكرة طي البروتين. وقد كتبتُ بضعة مقالات عن هذه المستشعرات التي صمَّمها، والتي يُعتبَر المقال التالي أكثرها شموليةً.
في البداية، كانت هناك مسألة طي البروتين؛ إذ تدرس فِرَقٌ بحثية عديدة حول العالم عمليةَ طيِّ البروتين (أو أحيانًا الحمض النووي الريبي)، أحيانًا بخلفية تكنولوجية حيوية أو للتعرُّف على الأنظمة البيولوجية، ولكن أحيانًا لمجرد التحدِّي الفكري الناتج عن معرفة الكيفية التي تُطوَى بها جزيئات السلاسل في شكل بنية ثلاثية الأبعاد شديدة التخصُّص بسرعةٍ وفاعليةٍ هائلتين، ولمعرفة السبب وراء ذلك.
أمضى كيفين بلاكسكو عدة سنوات من حياته المهنية في أبحاث الطي حتى كوَّنَ فريقه البحثي الخاص في جامعة كاليفورنيا بسانتا باربرا. ولأنه كان يبحث عن شيء مفيد يوظِّف فيه خبرته في طي البروتينات، واتَتْه فكرة استخدام عمليات الطي في المستشعرات، وكان أول جهاز يصمِّمه فريقه عبارة عن مستشعر جيني يُسمَّى «إي-دي إن إيه» E-DNA، ويحتوي على تسلسل مِسبار حمض نووي مطويٍّ، لن يتمدَّد إلا عندما يظهر التسلسُلُ المطابِق المستهدف. وعندما يتمدَّد الحمض النووي، فإنه يزيل علامةَ الفيروسين المثبتة بأحد طرفَيْه من سطح الذهب الذي يُثبَّت فيه الطرف الآخَر، وبالتالي يكبت الإشارة الكهروكيميائية التي سُجِّلت من قبلُ. يمكن استخدام الحمض النووي لأغراض عديدة (كما سبق أن شرحتُ في الفصل الذي يتحدَّث عن سوء استغلال الحمض النووي)، بما في ذلك التعرُّف الجزيئي على أنواع أخرى من الجزيئات المستهدَفة. تُعرَف جزيئات الحمض النووي، التي تتمتَّع بخواص ارتباط عالية التخصُّص ومنتقاة من مستودع ضخم للتسلسلات العشوائية؛ بالأبتاميرات. ومنذ اكتشاف هذا المفهوم عام ????، أُعلِن عن الأبتاميرات ذات التخصُّصات العديدة المختلفة، التي كانت تُستخدَم في العديد من التطبيقات، بما في ذلك المستشعرات المعتمدة على التألق الفسفوري، المعروفة باسم إشارات الأبتاميرات. وفي عام ????، استعان فريق بلاكسكو، بالتعاون مع زميلهم آلان هيجر المنتمي لنفس الجامعة والحائز جائزة نوبل، بأحد هذه الأبتاميرات ذي الفعالية الخاصة ضد عامل تجلُّط الدم المتمثِّل في الثرومبين، لتحويل مستشعر «إي-دي إن إيه» إلى مستشعر إلكتروني معتمِد على الأبتامير (إي-إيه بي) الخاص بهذا العامل.
أثبت هذا المستشعر الكهروكيميائي الأول المعتمِد على الأبتامير تخصصيةً عالية للغاية؛ إذ لم يكن من الممكن تحفيزُ تغيُّر الإشارة إلا بواسطة طيِّ أبتامير الحمض النووي حول جزيء الثرومبين المستهدف، وهو حدث أكثر تخصُّصًا من عمليات الالتحام البسيطة. ومثل مستشعر «إي-دي إن إيه»، فإنه كان يتميَّز بكونه مستشعرًا يفتقر إلى المادة الكاشفة؛ مما يوحي بأن هذه التكنولوجيا يمكن تطويرها لتصميم جهاز بسيط محمول باليد، لن يضطر المستخدِم معه إلا إلى غمس الجهاز في العيِّنة لتحليلها. يقول بلاكسكو: «تحويل الإشارات الجزيئية إلى إلكترونيَّة له تأثير كبير على ملاءمتها. ونظرًا لأن الخلفية الكهروكيميائية لعيِّنة فعلية نمطية مثل مصل الدم تُعتبَر أصغر بعدة قيم أسية من خلفيتها الاستشعاعية، تستطيع المستشعرات الكهروكيميائية أن تعمل في عينات غير نقية بالمرة.»
شكل ??-?: أمثلة لمستشعر أبتامير منطفئ الإشارة (بالأعلى) ومستشعر أبتامير مفتوح الإشارة للكشف عن الثرومبين. في حالة المستشعر المنطفئ الإشارة، يؤدِّي ارتباطُ جزيء الثرومبين إلى تكوين بنية ثانوية في أبتامير الحمض النووي؛ مما يجعله صلبًا بحيث لا يقترب من السطح بالقدر الذي يكفي لنقل الإلكترون. وعلى العكس من ذلك، ففي حالة المستشعر المفتوح الإشارة، ينطلق الحمض النووي ببنية اللولب المزدوج. ويشغل التعرُّف على الجزيء المستهدف جديلة حمض نووي واحدة؛ مما يترك الجديلة الثانية حرَّةً لتتحرك وتنتج إشارةً كهروكيميائيةً.
ومع هذا، يعيب كلًّا من مستشعر الثرومبين ومستشعر «إي-دي إن إيه» الأصلي أنهما مستشعران «منطفِئا الإشارة»، أيْ إن الإشارة المسجَّلة في غياب الجزيئات المستهدفة تضعف عندما يتم رصد هذه الجزيئات. وهنا يتفوق الفريق المنافس بقيادة سيارا أوسوليفان من جامعة روفيرا إي فيرجيلي في مدينة تاراجونا بإسبانيا؛ فقد ابتكروا أيضًا مستشعِرَ ثرومبين معتمِدًا على الأبتامير، إلا أن الاختلافات الكيميائية المعقدة التي تميِّز تصميمَ تسلسل الأبتامير قد أتاحت لجهازهم أن يعمل في وضع «الإشارة المفتوحة» المطلوب.
كان على فريق بلاكسكو بذل مجهود إضافي في مستشعر «إي-إيه بي» لتمكينه من العمل في وضع الإشارة المفتوحة (انظر الشكل ??-?)؛ وهو ما أدَّى إلى تحسين حساسيته بمقدار عشرة أضعاف. ويشرح بلاكسكو ذلك قائلًا: «عندما نجعل مستشعرنا يعمل بنمط الإشارة المفتوحة، فإننا ننتقل من ضعف بنسبة ??? في قوة الإشارة عند التشبُّع إلى زيادة بنسبة ???? في قوتها.» علاوة على ذلك، صمَّمَ فريق سانتا باربرا جهازًا عاليَ الحساسية للكشف عن الكوكايين حتى في السوائل البيولوجية وفي البيئات التي يُخفَى فيها وجوده عن عمدٍ. ويصف أحدثُ أبحاثهم مستشعرًا للكشف عن عامل النمو المشتق من الصفائح الدموية الحسَّاس بدرجةٍ تجعله مفيدًا في تشخيص السرطان. وعلى عكس المستشعرات المعتمِدة على التألُّق الفسفوري التي صمَّمَتْها فِرَق بحثية أخرى لنفس الغرض، فإن هذا الجهاز الكهروكيميائي يمكن استخدامه مباشَرةً مع مصل الدم، شريطةَ أن يُخفَّف مصل الدم بمقدار ضِعفين لتقليل القوة الأيونية للعيِّنة.
(????)
أحدث التطورات

في أكتوبر ????، أعلن فريق بقيادة جوزيف وانج من جامعة ولاية أريزونا، في مدينة تيمبي، عن نظام استشعار معتمِد على الأبتامير وذلك باستخدام أبتاميرين، وتقع حساسيته في نطاق الفيمتومولار (????? مول للتر). قراءات إضافية

Y. Xiao et al. Angew. Chem. Int. Ed. 2005, 44, 5456.
Y. Xiao et al., J. Am. Chem. Soc. 2005, 127, 17990.
A.-E. Radi et al., J. Am. Chem. Soc. 2006, 128, 117.
B. R. Baker et al., J. Am. Chem. Soc. 2006, 128, 3138.
R. Y. Lai et al., Anal. Chem. 2007, 79, 229.
Y. Xiang et al., Angew. Chem. Int. Ed. 2007, doi 10.1002/anie.200703242.

الفصل الحادي والعشرون
نظرية كرة الشعر تحل مشكلة كيميائية


جسيمات النانو عبارة عن ذرات متناهية الصِّغَر من المادة يُقاس كلٌّ منها ببضعة أجزاء من المليون من الملِّيمتر، وهي جسيمات فردية مستديرة في العادة، لدرجة أنه من الصعب إشراكها في أي تفاعلات تعتمد على التفضيلات البنيوية. وقد أعلن باحثون من معهد ماساتشوستس للتكنولوجيا في كامبريدج بولاية ماساتشوستس، في يناير ????؛ أنهم قد نجحوا في فكِّ تناظر جسيمات النانو باستخدام قاعدة حسابية تُعرَف باسم نظرية كرة الشعر، وهو ما أعتبره طريقة رائعة للغاية لإدخال علم الطوبولوجيا النظري إلى حدٍّ ما والغريب غالبًا (الذي يخبرك بأن قدح القهوة وكعكة الدونت المُحلَّاة لهما نفس الشكل؛ أيْ متكافئين طوبولوجيًّا!) إلى حيِّز التطبيق العملي.
تنص نظرية كرة الشعر على أن المرء لا يستطيع تمشيط كلِّ الشعر الموجود فوق جسم كروي مغطًّى بالوبر كي يصبح أملس من دون أن يكوِّن ما لا يقل عن كرتين وبريَّتَيْن، فيما يُعرَف علميًّا باسم التفرُّدات. وعلى النقيض من ذلك، يمكن تمشيط جسمٍ مكسوٍّ بالشعر على شكل كعكة الدونت (حلقة مستديرة) ليصبح أملسَ من دون أية مشاكل.
يطلق علماء الرياضيات المتحدثين بالألمانية على هذه النظرية اسمَ نظرية القنفذ؛ لأنها تدل أيضًا على أن القنفذ إذا التفَّ حول نفسه فسيكون ضعيفًا في بعض المناطق. وتفيد النظرية كثيرًا من الأشخاص بطرق عدة. على سبيل المثال، بالنسبة إلى علماء الأرصاد الجوية فإنها تتنبَّأ بأنه ما دامت توجد رياح على كوكبنا فلا بد من وجود إعصار أو مرتفع جوي في مكانٍ ما. وعلى العكس من ذلك، إذا هبطتَ على كوكب به رياح من دون أعاصير، فستعرف فورًا أنه أشبه بكعكة الدونت الكبيرة. من البديهي أن تكون هذه النظرية مهمة لمصفِّفي الشعر، ولكن ماذا عن علماء الكيمياء؟
قرَّرَ فريق بقيادة فرانسيسكو ستيلاتشي من معهد ماساتشوستس للتكنولوجيا، خلال سعيهم لاستخدام جسيمات النانو في بناء بنًى معقَّدة؛ أن يصقلوا مهاراتهم الحسابية ويطبِّقوا النظرية على علم الكيمياء. وبناءً على ذلك، فقد حوَّلوا جسيمات النانو الذهبية إلى كرات فراء متناهية الصِّغَر، عن طريق ترسيب طبقات أحادية ذاتية التكوين من الثيول على أسطحها، وباستخدام الميكروسكوب الإلكتروني النافِذ، استطاع الباحثون إثبات أن مركبات الثيول قد رتَّبَتْ نفسها في حلقات متوازية، مثل الدبابيس المثبتة في مجسَّم الكرة الأرضية على امتداد دوائر العرض. وتظهر التفردات في صورة جزيئات فردية من الثيول بارزة من كلِّ قطب. وعلى عكس الجزيئات الموجودة في الحلقات، فإن الجزيئات القطبية لا يتحقَّق لها الاستقرار من خلال الجزيئات المجاورة، وبالتالي من السهل إزاحتها مقارَنةً بالجزيئات الأخرى.
شكل ??-?: تتنبَّأ نظرية كرة الشعر — من بين أمور أخرى — بأن الكوكب الذي تهبُّ فيه الرياح لا بد أن يشهد دائمًا إعصارًا واحدًا على الأقل، ما لم يكن هذا الكوكب حلقيَّ الشكل (على شكل كعكة الدونت)، حيث تظل الرياح في حالة دوران مستمر دون أن تكوِّن أي أعاصير.
استطاع فريق معهد ماساتشوستس للتكنولوجيا أن يستبدل بالثيول القطبي «مقابض» سلسلية تحمل مجموعات من حمض الكربوكسيل في الطرف الآخر. وعلاوة على ذلك، قاموا ببلمرة هذه البِنى عن طريق تعريضها للتفاعل المعروف على نطاقٍ واسعٍ والمُستخدَم في إنتاج النايلون؛ فأذابوا جسيمات النانو المغطَّاة في التولوين، وجمعوها معًا بواسطة محلول مائي يحتوي على مركب أحادي وسداسي الهكسين الثنائي الأمين، واستطاعوا بعد ذلك جمعَ بوليمر جسيمات النانو من الحد الفاصل بين هذين السائلين غير القابلين للامتزاج، تمامًا مثلما يحدث في حالة النايلون.
يعتقد ستيلاتشي، رئيس الفريق، أن هذا البحث سيفيد كلًّا من مجال العلوم الأساسية والتطبيقات الحديثة، ويشرح ذلك قائلًا: «لقد صنعنا مقابلًا نانويًّا للبوليمرات، ونتوقع أن تُثبِت هذه المواد صحةَ بعض الافتراضات الجوهرية حول فيزياء البوليمرات، وأن تقدِّم وفرة من الخواص الجديدة.»
يقول رائد تكنولوجيا النانو كيس ديكر، من جامعة دلفت للتكنولوجيا بهولندا، المتحمِّس بشدة للتطور الجديد: «هذا عمل مبتكر للغاية قد يفتح آفاقًا جديدة لاستخدام جسيمات النانو.» ويتابع قائلًا: «إنه يضيف وظيفةً جديدةً لها، وتحديدًا القدرة على الارتباط بجسيمات أخرى في اتجاهات محدَّدة، تمامًا مثلما تكوِّن الذرات الجزيئات.»
وبالتالي، فالنظرية التي لا تسبِّب سوى المتاعب للقنافذ ومصفِّفي الشعر وعلماء الأرصاد الجوية قد أثبتَتْ فعلًا فائدتَها الهائلة بالنسبة إلى علماء الكيمياء.
(????)
قراءات إضافية

G. A. DeVries, et al., Science, 2007, 315, 358.

الفصل الثاني والعشرون
مرآة سائلة للقمر


عرفتُ بشأن السوائل الأيونية لأول مرة في ورشة عمل للمواد المحفِّزة عام ????، وقد أبهرتني آنذاك، ولكني لم أتخيَّلْ أن العلماء سيناقشون ذات يومٍ إمكانيةَ إرسال مثل هذه السوائل إلى القمر. لقد نجح الباحثون في تغطية سائلٍ أيوني ذي سطح عاكس؛ وهو ما يجعله صالحًا (تقريبًا) لتليسكوب على سطح القمر يعتمد على مرآة ذات قَطْع متكافِئ مصنوعة من سائل دوَّار. ونظرًا لأن هذا التليسكوب ستكون درجة حرارته ??? درجة كلفينية تقريبًا، فإنه سيكون شديد البرودة.
لطالما تحدَّثَ علماء الكونيات عن أن وضع تليسكوب على سطح القمر بمرآة ذات قَطْع متكافئ مصنوعةٍ من سائل دوَّار، سيكون مناسبًا على نحو مثالي لدراسة البِنَى البعيدة للغاية (وبالتالي الشديدة القِدَم) في الكون بتفاصيل غير مسبوقة. وقد نجح علماء الكيمياء الآن في ابتكار نظام سائلي يقترب إلى حدٍّ كبير من متطلبات مثل هذا المشروع.
اختبر إيرمانو بورا من جامعة لافال في كندا، بالتعاون مع زملائه في أماكن أخرى في كندا والولايات المتحدة وأيرلندا الشمالية، خواصَّ عدة أنواع مختلفة من السوائل وحدَّدَ سائلًا أيونيًّا تجاريًّا باعتباره المرشَّح الأكفأ لهذا المشروع.
السوائل الأيونية بصفة أساسية عبارة عن أملاح تظل سائلة في درجات الحرارة المحيطة، وأحيانًا في درجات الحرارة الشديدة البرودة. وعلى مدار السنوات القليلة الماضية، ربط الباحثون بين عدة أنواع مختلفة من الجزيئات المشحونة لتكوين مثل هذه الأملاح السائلة، وقد أثبتَتْ نجاحَها في أبحاث المواد المحفِّزة. وهي مهمة بصفة خاصة كمواد مذيبة «خضراء»؛ إذ إنها لا تتبخَّر (على عكس المواد المذيبة العضوية المعتادة التي تميل إلى التطاير)، وهو ما يُعتبَر أيضًا ميزتها الأساسية في التطبيقات الفضائية.
عندما استخدم الباحثون الفضة لرش سطح السائل الأيوني المختار — المتمثِّل في كبريتات إيثيل أحادي إيثيل ثلاثي الميثيليميدازوليوم — وتغطيته، اكتشفوا انعكاسًا أفضل بكثير في نطاق الطول الموجي المعنيِّ للأشعة تحت الحمراء، مقارَنةً بطبقات التغطية الفضية على أنواع أخرى من السائل، مثل البولي إيثيلين جليكول.
بتحليل سطح السائل الأيوني المغطَّى بالفضة، اكتشف بورا وزملاؤه جسيمات غروانية بحجم بضع عشرات من النانومترات. وبافتراض أن هذا الأمر كان السببَ في أن القدرة الانعكاسية لم تكن جيدةً بما يكفي مثلما كان الأمر في حالة الفضة في صورتها الفلزية النقية، فقد غيَّروا طريقتهم بحيث تتضمَّن طبقةً من الكروميوم قبل إدخال الفضة. وحسبما يقول الباحثون، فقد أثبَتَ السائل الناتج المزدوج التغطية قدرةً انعكاسية أكبر لدرجة أنه لا يتبقَّى سوى ضبط تكنولوجي طفيف.
بالمثل، فإن نقطة انصهار السائل الأيوني التجاري المستخدَم كقاعدةٍ لا تُعتبَر منخفضةً بما يكفي لضمان أن تظلَّ المادة سائلةً في درجات الحرارة المحيطة على سطح القمر، إلا أن الباحثين يؤكِّدون ثقتهم بأن من بين ملايين الاندماجات المحتمَلة للأيونات، سيمكن تحديد الاندماج المثالي للتليسكوب القمري.
ولكن هل هذا هو مستقبل علم الفلك أم أنه محض جنون؟ رحَّبَ بول هالبيرن، أستاذ الفيزياء بجامعة العلوم في فيلادلفيا، ومؤلِّف عدة كتب عن علم الكونيات، بالمشروع بحماسٍ؛ إذ يقول: «قد يصبح تصميمُ تليسكوب قمري مجديًا حقًّا من الناحية الاقتصادية.» ويختتم كلامه بقوله: «لهذا السبب، قد يكون استخدامُ طبق دوَّارٍ عملاقٍ يحتوي على سائل ذي قدرة انعكاسية هائلة هو الحل المثالي؛ إذ يستطيع تليسكوب عاكِس قطره ??? متر أن يجمع الضوءَ بآلاف الأضعاف مقارَنةً بتليسكوب هابل الفضائي، وربما يصوِّر النجومَ البدائية التي يُعتقَد أنها نشأت في بداية الكون.»
(????)
قراءات إضافية

E. F. Borra et al., Nature, 2007, 447, 979.

الفصل الثالث والعشرون
خاتمة: السنوات الخمس عشرة القادمة


عندما تأملتُ المقالات التي كتبتُها خلال السنوات الخمس عشرة الماضية لكي أنتقي من بينها المقالات التي جمعتُها في هذا الكتاب، أدركتُ كم كانت بعضُ توقُّعاتي المتفائلة عديمةَ الجدوى! ففي خضم الحماس الذي يعتري المرء تجاه اكتشاف جديد، ينساق المرء بسهولة وراء هذا الاكتشاف ويستنتج أحدث التطورات المؤدية إلى مستقبلٍ ورديٍّ. يحمل توقُّعي النموذجي المعنى التالي على الدوام: الآن بعدما حُسِمت المسائل الجوهرية، ينبغي أن تصبح التطبيقات العملية ممكنةً خلال السنوات الخمس (أو ربما العشر) القادمة.
ولكن هل حدث هذا فعلًا؟ في بعض الحالات، وجدتُ ما يدعم نظرتي التفاؤلية؛ فبروتين الفلورسنت الأخضر (انظر مقال «الشُّعلة الخضراء» ومقال «بروتينات إشارة المرور الجزيئية») وتداخُل الحمض النووي الريبي (انظر مقال «إسكات النشاز») انتشَرَا في الإجراءات المعملية خلال بضعة أشهر. وفي حالات أخرى، كانت نظرتي متفائلة أكثر من اللازم؛ إذ ظهرت عقبات غير متوقَّعة في الخطوات التي أعقبَت الاكتشاف المذهل. وبناءً عليه، يظل العلاج الجيني بعيدَ المنال، مثلما كان حاله في منتصف تسعينيات القرن العشرين. كما كان يُعتبَر الرودوبسين الجرثومي وغيره من الجزيئات الحيوية من البدائل المشوقة للحوسبة، إلا أن التقدُّم السريع في شرائح السليكون، التي لا تزال تتبع قانون مور حتى اليوم، قد صرف النظر عن هؤلاء المتبارين. فضلًا عن أن التعبير الجيني عن بروتينات الحرير العنكبوتي في ألبان الماعز (انظر مقال «دروس في الغَزْل») لم يُثمِر إنتاجًا لحرير العنكبوت بكميات يمكن الاستفادة بها.
معروف للأسف عن النبوءات أنها ترتدُّ على المتنبئ القليل الحظ. وربما لا يكون تفاؤلي معرقِلًا بقدر تلك التوقُّعات السلبية المُستشهَد بها دومًا كنوع من الإدراك المتأخر، كالحال على سبيل المثال عند توقُّع أن الطائرات لن تطير أبدًا، أو أن أجهزة الكمبيوتر الشخصية لن تُباع أبدًا. ولكن مع هذا، على المرء توخِّي الحيطة والحذر عند التنبؤ بالمستقبل الذي لا يمكن التنبُّؤ به.
بعد قولي هذا، لا يسعني تقديم بعض التخمينات حول المقالات التي قد أُضمنها لو قرَّرتُ أن أجهِّز مجموعةً مماثلة بعد خمسة عشر عامًا. هذا، بالطبع، لو ظلَّتِ الكتبُ موجودةً حتى عام ????؛ فاستبدال الكتب الإلكترونية بها هو أحد التوقُّعات التي طالما قرأتُ عنها باستمرار على مدار أعوام، دون أن تظهر في الأفق أيةُ إشاراتٍ تدل على تحقُّقها فعليًّا.
لن تكون المشكلات العالمية الحالية — بدءًا من الازدحام السكاني وصولًا إلى الاحتباس الحراري — قد اختفَتْ بعدُ، ولكن من المأمول أننا سنكون قد اقتربنا من حلول بنَّاءة. (ها هو تفاؤلي السريع يلوح مجدَّدًا في الأفق، في واقع الأمر، يجب أن نعتبر أنفسنا محظوظين لو لم نكن قد محونا المحيط الحيوي بحلول ذلك الوقت!) بطريقةٍ ما، فإن الوسائل التكنولوجية المتقدمة، التي أكتب عنها غالبًا، لن تكون مهمةً بالنسبة إلى مصير البشرية على المستوى العالمي بقدر الوسائل التكنولوجية القوية التي يمكن أن تساعد أغلبَ البشر الذين ما زالوا يكافحون الجوعَ والأمراضَ المُعديَة بصفتهما عدوَّيْهم الرئيسَيْن.
إن التطعيمات الميسورة التكلفة بالنسبة إلى الأمم الفقيرة، أو العقاقير التي يمكن تخزينها دون الحاجة إلى ثلاجة، أو أجهزة الكمبيوتر التي يمكن أن تنقل الثورةَ المعلوماتية إلى مجاهل أفريقيا، هذه هي الأمور التي من المرجح أن يكون لها أثر أكبر على مدار السنوات الخمسة عشر القادمة مقارَنةً بأية شريحة من الجيل التالي تصيب جهازَ الكمبيوتر بعطل مفاجئ بمعدل أسرع، أو عقَّار يطيل متوسط عمر الأثرياء من ?? عامًا إلى ?? عامًا. بعبارة أخرى، لن يعتمد مصيرُ العالم بصورة حاسمة على مدى سرعة تقدُّم العلوم والتكنولوجيا المتطورة، وإنما على مدى القدرة على مواكبة هذا التقدُّم واللحاق بالرَّكْب.
لكن إذا نظرنا إلى العلوم من حيث كونها نشاطًا ممتعًا وحافزًا فكريًّا، فسوف نشعر بالطبع بكثير من التشويق تجاه التكنولوجيا المتقدِّمة. وإذا وضعنا في الاعتبار أن هذه الإنجازات لن تجعل عالمنا مكانًا أفضل، فإليكم بعض الأمور الغريبة والمثيرة والرائعة التي أتمنَّى أن أستطيع ضمَّها في كتابي القادم: كمبيوتر كمي فعلي: دعونا نتخلَّص من التجارب النظرية. لن يصدِّق الناسُ أن ميكانيكا الكم صالحة للتطبيق العملي ما لم يجدوها على مكاتبهم تنفِّذ معظمَ أعمالهم نيابةً عنهم، في حين ينشغلون هم بممارسة ألعاب الواقع الافتراضي.
إصلاح الروابط العصبية: في العديد من الحالات، سيكون من الغباء الشديد أن يظل الناس عاجزين عن تحريك أطرافهم أو الرؤية أو السمع، لمجرد أن هناك فجوة صغيرة في العصب المسئول. يمكننا إصلاح الكابلات الكهربائية، وهو ما يعني أن إصلاح الأعصاب يجب أن يصبح إجراءً روتينيًّا بحلول عام ????.
استبدال أعضاء بسيطة: لا تشغل بالك بما إن كانَتْ أعضاءً صناعيةً أم بيولوجية، فلن يستطيع أحدٌ أن يميِّز الفارقَ بينهما (أذكِّركم بمقال «الإلكترونيات البيولوجية» مجدَّدًا!) بالنسبة إلى أعضاء — مثل الكُلَى أو القلب — تستطيع آلةٌ أداءَ وظائفها خارج الجسم، فلا يوجد سبب مقنع يمنع ابتكار آلة جديدة (سواء تمَّ تصميمها أو استزراعها) تؤدِّي وظائفَ هذه الأعضاء داخل الجسم. وقد يستغرق الأمر مع الكبد وقتًا أطول، كما سيسبِّب تطبيقُ نفس المنهج على المخ مشكلة هوية؛ لذا دعونا نترك هذا للجيل القادم.
مواد جديدة مثيرة: سواء أكانت حريرَ العنكبوت أم الأنابيبَ النانوية الكربونية، أرغب في مواد جديدة تفتح آفاقًا جديدة، مثل مصاعد الفضاء أو الأعضاء الصناعية.
فهم الكون: بدافع الفضول لا أكثر، أريد أن أعرف ما يشكِّل نسبة ا? ??? من الكون التي لا نعرف عنها شيئًا. وكميزة إضافية فقد نكتشف أيضًا المصيرَ المستقبلي للكون، ولا يعني هذا أن الأمر سيكون له مردوده علينا، فلن نعيش كلَّ هذه المدة الطويلة كي نشهد أيَّ تغيُّرات ملحوظة في البنية الهائلة للكون بطريقة أو بأخرى. ولكني متحيِّر بشأن حضارتنا؛ لأننا مضطرون إلى الاعتراف بأننا لا نفهم المكانَ الذي نعيش فيه.
من الممكن بالطبع ألَّا تتحقَّق هذه التوقعاتُ، أو أن يتحقَّق بعضها فقط، ولكن العديد من التوقُّعات الأخرى سيتحقَّق، وسيوجد المزيد من الاكتشافات غير المتوقَّعة على نحوٍ غريب، والرؤى المثيرة على نحوٍ لا يُقاوَم، والابتكارات الرائعة إلى حدٍّ مبهر، وجميعها سيُعلَن عنها خلال السنوات القادمة، وهذا ما يدفعني إلى المضي قدمًا ومواصلة ما بدأتُه.

الفصل الرابع والعشرون
مصادر الصور


الجزء الأول

(1-1) From: http://en.wikipedia.org/wiki/Image: Hypsibiusdujardini.jpg.
(2-1) Exzentriker des Lebens, 1997 © Spektrum Akademischer Verlag GmbH, Heidelberg, Spektrum Akademischer Verlag is a imprint from Springer SMB.
(10-1) © Nature Publishing Group.
(13-1) Reprinted by permission from Macmillan Publishers Ltd: Nature vol. 432, p. 456, copyright 2004.
(16-1) Exzentriker des Lebens, 1997 © Spectrum Akadimischer Verlag GmbH, Heidelberg, Spektrum Akademischer Verlag is a imprint from Springer SMB.
(17-1) Brad Norman/Earthwatch.
(20-1) © Neanderthal Museum/M. Pietrek.
الجزء الثاني

(4-1) From the RSCB Protein Data Bank.
(9-1) From Gray’s Anatomy, 1918.
(11-1) From: Stoltzenberg, Dietrich: Fritz Haber. Chemiker Nobelpreistr?ger, Deutscher Jude. Wiley-VCH GmbH, Weinheim 1998, S. 481.
(14-1) From: http://en.wikipedia.org/wiki/Image: Platypus.jpg. Photo by Stefan Kraft.
(15-1) © Digital Vision.
الجزء الثالث

(7-1) From: Richard D. Pines, Jin Zhu, Freng Xu, Seunghun Hong, Chad A. Mirkin, Science 283, 661 (1999). Reprinted with permission from AAAS.
(10-1) New Scientist, 24. 4. 1999.
(19-1) © PhotoDisc/Getly Images.